ID: 978399308

View in Genome Browser
Species Human (GRCh38)
Location 4:108314107-108314129
Sequence CCCTGGGATGTCTTGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978399308_978399324 24 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data
978399308_978399321 15 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399321 4:108314145-108314167 TCCCAGGACTGGCTTAGAAGGGG No data
978399308_978399319 13 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399308_978399320 14 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399320 4:108314144-108314166 CTCCCAGGACTGGCTTAGAAGGG No data
978399308_978399316 -1 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399308_978399317 4 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978399308 Original CRISPR CCCTGGGATGTCTTGGTCTT GGG (reversed) Intergenic
No off target data available for this crispr