ID: 978399316

View in Genome Browser
Species Human (GRCh38)
Location 4:108314129-108314151
Sequence GACTCAGGGATGCTCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978399311_978399316 -8 Left 978399311 4:108314114-108314136 CCAAGACATCCCAGGGACTCAGG No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399306_978399316 7 Left 978399306 4:108314099-108314121 CCGACTAACCCAAGACCAAGACA No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399305_978399316 12 Left 978399305 4:108314094-108314116 CCACGCCGACTAACCCAAGACCA No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399304_978399316 19 Left 978399304 4:108314087-108314109 CCTGGAGCCACGCCGACTAACCC No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399308_978399316 -1 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data
978399310_978399316 -2 Left 978399310 4:108314108-108314130 CCAAGACCAAGACATCCCAGGGA No data
Right 978399316 4:108314129-108314151 GACTCAGGGATGCTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978399316 Original CRISPR GACTCAGGGATGCTCCTCCC AGG Intergenic
No off target data available for this crispr