ID: 978399317

View in Genome Browser
Species Human (GRCh38)
Location 4:108314134-108314156
Sequence AGGGATGCTCCTCCCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978399311_978399317 -3 Left 978399311 4:108314114-108314136 CCAAGACATCCCAGGGACTCAGG No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data
978399310_978399317 3 Left 978399310 4:108314108-108314130 CCAAGACCAAGACATCCCAGGGA No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data
978399304_978399317 24 Left 978399304 4:108314087-108314109 CCTGGAGCCACGCCGACTAACCC No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data
978399306_978399317 12 Left 978399306 4:108314099-108314121 CCGACTAACCCAAGACCAAGACA No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data
978399305_978399317 17 Left 978399305 4:108314094-108314116 CCACGCCGACTAACCCAAGACCA No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data
978399308_978399317 4 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399317 4:108314134-108314156 AGGGATGCTCCTCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978399317 Original CRISPR AGGGATGCTCCTCCCAGGAC TGG Intergenic
No off target data available for this crispr