ID: 978399319

View in Genome Browser
Species Human (GRCh38)
Location 4:108314143-108314165
Sequence CCTCCCAGGACTGGCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978399305_978399319 26 Left 978399305 4:108314094-108314116 CCACGCCGACTAACCCAAGACCA No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399314_978399319 -3 Left 978399314 4:108314123-108314145 CCCAGGGACTCAGGGATGCTCCT No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399315_978399319 -4 Left 978399315 4:108314124-108314146 CCAGGGACTCAGGGATGCTCCTC No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399308_978399319 13 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399310_978399319 12 Left 978399310 4:108314108-108314130 CCAAGACCAAGACATCCCAGGGA No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399306_978399319 21 Left 978399306 4:108314099-108314121 CCGACTAACCCAAGACCAAGACA No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data
978399311_978399319 6 Left 978399311 4:108314114-108314136 CCAAGACATCCCAGGGACTCAGG No data
Right 978399319 4:108314143-108314165 CCTCCCAGGACTGGCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978399319 Original CRISPR CCTCCCAGGACTGGCTTAGA AGG Intergenic
No off target data available for this crispr