ID: 978399324

View in Genome Browser
Species Human (GRCh38)
Location 4:108314154-108314176
Sequence TGGCTTAGAAGGGGCCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978399310_978399324 23 Left 978399310 4:108314108-108314130 CCAAGACCAAGACATCCCAGGGA No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data
978399314_978399324 8 Left 978399314 4:108314123-108314145 CCCAGGGACTCAGGGATGCTCCT No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data
978399311_978399324 17 Left 978399311 4:108314114-108314136 CCAAGACATCCCAGGGACTCAGG No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data
978399308_978399324 24 Left 978399308 4:108314107-108314129 CCCAAGACCAAGACATCCCAGGG No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data
978399315_978399324 7 Left 978399315 4:108314124-108314146 CCAGGGACTCAGGGATGCTCCTC No data
Right 978399324 4:108314154-108314176 TGGCTTAGAAGGGGCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978399324 Original CRISPR TGGCTTAGAAGGGGCCTGCT TGG Intergenic
No off target data available for this crispr