ID: 978401981

View in Genome Browser
Species Human (GRCh38)
Location 4:108340938-108340960
Sequence AGCTGCCAACAAATGGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978401974_978401981 8 Left 978401974 4:108340907-108340929 CCTGCAGACTGGAAGCCCCTGAT No data
Right 978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG No data
978401975_978401981 -7 Left 978401975 4:108340922-108340944 CCCCTGATAGCTTGAGAGCTGCC No data
Right 978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG No data
978401977_978401981 -9 Left 978401977 4:108340924-108340946 CCTGATAGCTTGAGAGCTGCCAA No data
Right 978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG No data
978401976_978401981 -8 Left 978401976 4:108340923-108340945 CCCTGATAGCTTGAGAGCTGCCA No data
Right 978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978401981 Original CRISPR AGCTGCCAACAAATGGGCTA GGG Intergenic
No off target data available for this crispr