ID: 978402756

View in Genome Browser
Species Human (GRCh38)
Location 4:108348420-108348442
Sequence CAGGGTTTAAACTCAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978402752_978402756 11 Left 978402752 4:108348386-108348408 CCCAGAGGGAATATGTCATATAC No data
Right 978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG No data
978402751_978402756 22 Left 978402751 4:108348375-108348397 CCTAATAAGAGCCCAGAGGGAAT No data
Right 978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG No data
978402753_978402756 10 Left 978402753 4:108348387-108348409 CCAGAGGGAATATGTCATATACT No data
Right 978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978402756 Original CRISPR CAGGGTTTAAACTCAGTTGC AGG Intergenic
No off target data available for this crispr