ID: 978403560

View in Genome Browser
Species Human (GRCh38)
Location 4:108356189-108356211
Sequence CCCATCTGGCACTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978403553_978403560 15 Left 978403553 4:108356151-108356173 CCTGGTCTTGGTCTCCACTGACT No data
Right 978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG No data
978403555_978403560 1 Left 978403555 4:108356165-108356187 CCACTGACTGAATCTGTTTGGAG No data
Right 978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978403560 Original CRISPR CCCATCTGGCACTGTGAGCT GGG Intergenic
No off target data available for this crispr