ID: 978404477

View in Genome Browser
Species Human (GRCh38)
Location 4:108364724-108364746
Sequence ATGGGGAAGCAGGAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978404477_978404491 20 Left 978404477 4:108364724-108364746 CCACCCTCCTCCTGCTTCCCCAT No data
Right 978404491 4:108364767-108364789 CACTGGCAGCTAATTGCACCTGG No data
978404477_978404482 -7 Left 978404477 4:108364724-108364746 CCACCCTCCTCCTGCTTCCCCAT No data
Right 978404482 4:108364740-108364762 TCCCCATCTTCCCACCTCAAAGG No data
978404477_978404492 29 Left 978404477 4:108364724-108364746 CCACCCTCCTCCTGCTTCCCCAT No data
Right 978404492 4:108364776-108364798 CTAATTGCACCTGGCACCCATGG No data
978404477_978404488 3 Left 978404477 4:108364724-108364746 CCACCCTCCTCCTGCTTCCCCAT No data
Right 978404488 4:108364750-108364772 CCCACCTCAAAGGGCGACACTGG No data
978404477_978404484 -6 Left 978404477 4:108364724-108364746 CCACCCTCCTCCTGCTTCCCCAT No data
Right 978404484 4:108364741-108364763 CCCCATCTTCCCACCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978404477 Original CRISPR ATGGGGAAGCAGGAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr