ID: 978406044

View in Genome Browser
Species Human (GRCh38)
Location 4:108379873-108379895
Sequence CCCAGACTTGCTCTCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978406042_978406044 4 Left 978406042 4:108379846-108379868 CCTGTTCTTAACTAGATGCACAT No data
Right 978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978406044 Original CRISPR CCCAGACTTGCTCTCCTTTG TGG Intergenic
No off target data available for this crispr