ID: 978409973

View in Genome Browser
Species Human (GRCh38)
Location 4:108415977-108415999
Sequence GGTCTAATCCTGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978409967_978409973 12 Left 978409967 4:108415942-108415964 CCTGAGAGAGGAAAAGCAAGATT No data
Right 978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG No data
978409965_978409973 23 Left 978409965 4:108415931-108415953 CCCAGACTAGTCCTGAGAGAGGA No data
Right 978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG No data
978409966_978409973 22 Left 978409966 4:108415932-108415954 CCAGACTAGTCCTGAGAGAGGAA No data
Right 978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG No data
978409963_978409973 24 Left 978409963 4:108415930-108415952 CCCCAGACTAGTCCTGAGAGAGG No data
Right 978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978409973 Original CRISPR GGTCTAATCCTGAAAGTGGA TGG Intergenic
No off target data available for this crispr