ID: 978413918

View in Genome Browser
Species Human (GRCh38)
Location 4:108455559-108455581
Sequence ACAGAGAAGAGGACTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978413918_978413923 -6 Left 978413918 4:108455559-108455581 CCATCCCCAGTCCTCTTCTCTGT No data
Right 978413923 4:108455576-108455598 CTCTGTATACTCTTTCTAGATGG No data
978413918_978413924 12 Left 978413918 4:108455559-108455581 CCATCCCCAGTCCTCTTCTCTGT No data
Right 978413924 4:108455594-108455616 GATGGTCCCACCCTCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978413918 Original CRISPR ACAGAGAAGAGGACTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr