ID: 978415061

View in Genome Browser
Species Human (GRCh38)
Location 4:108466216-108466238
Sequence CTGTGGTTGCTGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978415061_978415069 19 Left 978415061 4:108466216-108466238 CCTACTTCCCTCAGCAACCACAG No data
Right 978415069 4:108466258-108466280 GAGCAGGCATGGGAGCCCTCCGG No data
978415061_978415065 3 Left 978415061 4:108466216-108466238 CCTACTTCCCTCAGCAACCACAG No data
Right 978415065 4:108466242-108466264 CTTTATTTCTCTTCCTGAGCAGG No data
978415061_978415066 8 Left 978415061 4:108466216-108466238 CCTACTTCCCTCAGCAACCACAG No data
Right 978415066 4:108466247-108466269 TTTCTCTTCCTGAGCAGGCATGG No data
978415061_978415067 9 Left 978415061 4:108466216-108466238 CCTACTTCCCTCAGCAACCACAG No data
Right 978415067 4:108466248-108466270 TTCTCTTCCTGAGCAGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978415061 Original CRISPR CTGTGGTTGCTGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr