ID: 978415815

View in Genome Browser
Species Human (GRCh38)
Location 4:108474785-108474807
Sequence ATGACCCAACACCTCCTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978415815_978415821 6 Left 978415815 4:108474785-108474807 CCTAGTAGGAGGTGTTGGGTCAT No data
Right 978415821 4:108474814-108474836 CAGATCCTTCATGAACGGCTTGG 0: 2
1: 42
2: 347
3: 736
4: 1177
978415815_978415823 30 Left 978415815 4:108474785-108474807 CCTAGTAGGAGGTGTTGGGTCAT No data
Right 978415823 4:108474838-108474860 GCCATCCCCCTGATAATGAGTGG No data
978415815_978415820 1 Left 978415815 4:108474785-108474807 CCTAGTAGGAGGTGTTGGGTCAT No data
Right 978415820 4:108474809-108474831 GGGGGCAGATCCTTCATGAACGG 0: 27
1: 272
2: 796
3: 1587
4: 2371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978415815 Original CRISPR ATGACCCAACACCTCCTACT AGG (reversed) Intergenic
No off target data available for this crispr