ID: 978415822

View in Genome Browser
Species Human (GRCh38)
Location 4:108474819-108474841
Sequence TGGCACCAAGCCGTTCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978415822_978415829 9 Left 978415822 4:108474819-108474841 CCTTCATGAACGGCTTGGTGCCA No data
Right 978415829 4:108474851-108474873 TAATGAGTGGATTTTCACTCTGG No data
978415822_978415823 -4 Left 978415822 4:108474819-108474841 CCTTCATGAACGGCTTGGTGCCA No data
Right 978415823 4:108474838-108474860 GCCATCCCCCTGATAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978415822 Original CRISPR TGGCACCAAGCCGTTCATGA AGG (reversed) Intergenic
No off target data available for this crispr