ID: 978415829

View in Genome Browser
Species Human (GRCh38)
Location 4:108474851-108474873
Sequence TAATGAGTGGATTTTCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978415822_978415829 9 Left 978415822 4:108474819-108474841 CCTTCATGAACGGCTTGGTGCCA No data
Right 978415829 4:108474851-108474873 TAATGAGTGGATTTTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978415829 Original CRISPR TAATGAGTGGATTTTCACTC TGG Intergenic
No off target data available for this crispr