ID: 978425100

View in Genome Browser
Species Human (GRCh38)
Location 4:108573731-108573753
Sequence TACCAGAAGCTGCTATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978425100_978425101 8 Left 978425100 4:108573731-108573753 CCAGTCTATAGCAGCTTCTGGTA No data
Right 978425101 4:108573762-108573784 TTCCAGTGTCACCTCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978425100 Original CRISPR TACCAGAAGCTGCTATAGAC TGG (reversed) Intergenic
No off target data available for this crispr