ID: 978426924

View in Genome Browser
Species Human (GRCh38)
Location 4:108592969-108592991
Sequence AAATAGAGACTATACGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978426917_978426924 11 Left 978426917 4:108592935-108592957 CCAAACCAATAAACAAAAGAAAG No data
Right 978426924 4:108592969-108592991 AAATAGAGACTATACGGTGGGGG No data
978426918_978426924 6 Left 978426918 4:108592940-108592962 CCAATAAACAAAAGAAAGCAACT No data
Right 978426924 4:108592969-108592991 AAATAGAGACTATACGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978426924 Original CRISPR AAATAGAGACTATACGGTGG GGG Intergenic
No off target data available for this crispr