ID: 978434043

View in Genome Browser
Species Human (GRCh38)
Location 4:108664256-108664278
Sequence GTATCCTTCCTTGTAACTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978434043 Original CRISPR GTATCCTTCCTTGTAACTAG TGG (reversed) Intronic
903552046 1:24164284-24164306 ATATCCTTCCTTTTCACTAAAGG + Intronic
904240701 1:29143127-29143149 GTATCCCACATTGTCACTAGCGG + Intergenic
909833508 1:80224526-80224548 GTGACCATCCCTGTAACTAGGGG - Intergenic
913551486 1:119921029-119921051 TTATCCTTCCTTGTAAAATGCGG - Intronic
914714500 1:150243097-150243119 GTATCTTTCATTGTAGATAGAGG + Intergenic
918733565 1:188030001-188030023 GTATACTTACTTGTAACTCCTGG - Intergenic
920426013 1:205875718-205875740 CTATCCTTCCTTAGAACTGGAGG - Intergenic
921902031 1:220461568-220461590 GTCTCTTTTCTTGTAACTTGAGG + Intergenic
1063355508 10:5395136-5395158 GTCTCCTTCCTAGTAACAAGGGG + Intronic
1064714099 10:18157726-18157748 CTATACTTCCTTGTAGCTAAAGG + Intronic
1067215672 10:44300639-44300661 GACTCCTTTCTTGTAGCTAGGGG - Intergenic
1067275604 10:44830376-44830398 GTATGCTTGTATGTAACTAGAGG - Intergenic
1071327339 10:84530217-84530239 CTATCCTTCCTTAGAACTGGAGG - Intergenic
1072378482 10:94840918-94840940 CTATCCTTCCTTAGAACTGGAGG - Intronic
1074855912 10:117473407-117473429 GTTTCCTTGCTTGTATCTTGGGG + Intergenic
1074964191 10:118474195-118474217 GTATCCTTCTCTGCAAATAGCGG - Intergenic
1077279725 11:1737703-1737725 TTATCCTTCCTGGTACCTTGAGG - Intronic
1078363236 11:10686421-10686443 GTATTTTTCCTTCTAAATAGAGG + Intronic
1079009760 11:16818244-16818266 GTTTCCTTACTTGTAACAGGAGG + Intronic
1084472448 11:69371033-69371055 GTTTCCTTGCTTGTAACCGGTGG + Intergenic
1086916460 11:92535034-92535056 GTGTCCTGCCTTATACCTAGAGG - Intronic
1087300041 11:96422051-96422073 ATATACTTCTTTGAAACTAGAGG - Intronic
1091396783 12:158010-158032 GGCTCCTTCCTTGTAAGTTGTGG - Intronic
1092435052 12:8440958-8440980 ATATCCTTCCTAGTATCCAGGGG + Intergenic
1092819794 12:12342622-12342644 GTCTCCTTCCTTGGAGCTGGTGG - Intronic
1093398796 12:18717040-18717062 ATATTTTTCCTTGTGACTAGTGG - Intronic
1094802600 12:34054082-34054104 ATATCCTTCCATGTAACTTTTGG - Intergenic
1095115762 12:38350023-38350045 ATATCCTTCCATGTAACTTTTGG - Intergenic
1095276497 12:40290370-40290392 TTATACTTCCTTGTAATTATGGG + Intronic
1097611070 12:61821230-61821252 GTATTTTACCTTTTAACTAGAGG - Intronic
1098746983 12:74251031-74251053 GCATCCTTCCTGGTAACCATAGG + Intergenic
1099437890 12:82665537-82665559 GTATCTCTCCTTGTAACAATGGG - Intergenic
1099508774 12:83508684-83508706 GAATTCTCCCTTGTCACTAGGGG - Intergenic
1100034600 12:90235515-90235537 GTATCCTTCTTTGTAATTAAAGG + Intergenic
1103802634 12:123549249-123549271 CTATCCTTCCTTGGAATTGGAGG + Intergenic
1105749869 13:23412822-23412844 GTAATATTCCTTGTAACTATTGG + Intronic
1106877046 13:34085574-34085596 TTCTCCTTCCATGTACCTAGAGG + Intergenic
1108748486 13:53420785-53420807 GTTTCCTTCCTTGTAAAATGAGG - Intergenic
1108876276 13:55054497-55054519 CTATCCTTCCTTGGAATTGGAGG + Intergenic
1110425807 13:75365074-75365096 GGATCCTTCCCTGTGACTACAGG + Intronic
1113002479 13:105658147-105658169 GTATCCATCCTTATTTCTAGAGG - Intergenic
1127649766 15:60995512-60995534 GTCTCCTTCCTTCAAACTGGTGG + Intronic
1128499179 15:68215159-68215181 AAATCCTTCCTTGAAACTTGTGG - Intronic
1129615385 15:77095016-77095038 TTATCCTTCCTGGTCTCTAGGGG + Intergenic
1131420196 15:92298739-92298761 CTATCCTTCCTTGGAATTGGAGG + Intergenic
1132083726 15:98889084-98889106 CCAGCCTTCCTTGTAGCTAGAGG - Intronic
1148429534 17:47631284-47631306 GTCTGCTTCCTTCTAACTACAGG - Intergenic
1153724638 18:7942498-7942520 GTATCCTGCCCTGTATCTGGAGG - Intronic
1155176635 18:23306925-23306947 GTTTCCTTCCCTGTGACCAGGGG - Intronic
1156644654 18:39146477-39146499 GTATCCATCCCTGTATCTACAGG + Intergenic
1162767175 19:12926845-12926867 GTTTCCTTCTTTGTAAAAAGGGG + Intronic
925685457 2:6467881-6467903 GGCTCCTTCCTTGTTTCTAGTGG + Intergenic
926864065 2:17339760-17339782 CTATCCTTCCTTAGAACTGGAGG + Intergenic
931187729 2:59969780-59969802 GTATCCTCCCTTATACCTGGGGG + Intergenic
937060256 2:118975428-118975450 GTTTCCTTTCTTGTAACTGGTGG - Intronic
939526107 2:143296357-143296379 GTTTTCTTTCTTGTAACTACAGG - Intronic
943682643 2:190784574-190784596 CTATCCTTCTTTGCAGCTAGTGG + Intergenic
944509817 2:200453548-200453570 TTTTCCTGCCTTGCAACTAGTGG + Intronic
1170085970 20:12531937-12531959 GTATCTTTCTTTGTAACTAGAGG - Intergenic
1172183538 20:33017960-33017982 TTCTCCTTCCTTCTAACTTGGGG + Intronic
1181762845 22:25069760-25069782 ATTTCCTTCCCTGTAACGAGTGG + Intronic
1183561018 22:38573013-38573035 GTATTCCTTCTTGTAACTGGAGG - Intergenic
950240964 3:11369607-11369629 GGATCCTTCCTTGTATTCAGAGG - Intronic
951201103 3:19876021-19876043 CTATCCTTCCTTAGAACTGGAGG - Intergenic
955102277 3:55861833-55861855 GTTTCCTTCCCTGTAACTTGGGG + Intronic
956720416 3:72112662-72112684 GTTTCCTTCCTTGTAAAATGGGG + Intergenic
957132992 3:76246331-76246353 GTATCATTTCTTGTAATTTGAGG + Intronic
964956405 3:162363318-162363340 GTATTTTTACTTTTAACTAGAGG + Intergenic
967623186 3:191659384-191659406 CTATCCTTCCTTAGAACTGGAGG + Intergenic
968222356 3:196948301-196948323 GTATCCTCCCATGTAACGTGGGG - Exonic
971380813 4:26095903-26095925 GGATCCTCCCTTAGAACTAGTGG - Intergenic
972038668 4:34560278-34560300 GTATCCTTCCTTTTAAAATGTGG - Intergenic
974929160 4:68341942-68341964 CTCTCCTTCCTTATAACTATTGG + Intronic
975281046 4:72563311-72563333 TTATTCTTTCTTGTAACTAAAGG - Intronic
975362542 4:73487908-73487930 ATATTCTTCCTAGTACCTAGGGG + Intronic
975492118 4:75000681-75000703 GTAGCCTTCTTTGCAACTAAGGG - Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
976960772 4:90969413-90969435 GTTTCCTTGCTTATAACAAGTGG - Intronic
978434043 4:108664256-108664278 GTATCCTTCCTTGTAACTAGTGG - Intronic
978736091 4:112086250-112086272 CTTCCCTTCCTTGTACCTAGTGG + Intergenic
980443888 4:132882865-132882887 CTATCCTTCCTTAGAACTGGAGG + Intergenic
980837141 4:138209375-138209397 TTATTCTCCCTTGTAACTAAAGG + Intronic
984339928 4:178444056-178444078 GAATCCTTCATTGCAACTACAGG + Intergenic
984384730 4:179041559-179041581 GTTTCCTTCTTGGTAACAAGGGG - Intergenic
988771577 5:34438272-34438294 GTTTCCTTCCTGGTCACTACTGG + Intergenic
990373251 5:55142500-55142522 TTATCCTTTCTGGTAACTGGTGG - Intronic
992272996 5:75085136-75085158 GGATCATTCCTTGAAACTAGAGG - Intronic
993300664 5:86205490-86205512 TCATCCTTCCTTGTGACTAAAGG + Intergenic
993400778 5:87447999-87448021 GTTTCCTTCTTTGTAAATGGGGG + Intergenic
994957161 5:106546718-106546740 GTACCCTTTCTTGCATCTAGAGG - Intergenic
995901107 5:117067269-117067291 CCATCCTTACTTGTAGCTAGAGG + Intergenic
997680905 5:135750049-135750071 GTATCCTACCTTGTGCCTATTGG + Intergenic
1001228859 5:169968699-169968721 GTACCCTTCCTAATAACTAGCGG - Intronic
1009544397 6:65005560-65005582 CTATCCTTCCTTAGAACTGGAGG + Intronic
1011540304 6:88420883-88420905 CTATCCTTCCTTAGAACTGGAGG - Intergenic
1026341128 7:69434897-69434919 GTATTGTTTCTTCTAACTAGTGG - Intergenic
1028131804 7:87184314-87184336 CTATCAGTCCTTGTAAATAGAGG + Intronic
1030296526 7:107934437-107934459 GTATCCTTCCTTGAAAACACAGG + Intronic
1030517240 7:110553420-110553442 GTCTGTTTCCTTGTAACTGGTGG - Intergenic
1031264410 7:119566198-119566220 TTATCCTTCCTTAGAACTGGAGG + Intergenic
1033017793 7:137689804-137689826 CAAGTCTTCCTTGTAACTAGAGG + Intronic
1038894185 8:31762654-31762676 CTATCCAGCATTGTAACTAGAGG - Intronic
1040060001 8:43095825-43095847 CAATCCTTCCTTGCCACTAGTGG - Intronic
1044544673 8:93446553-93446575 GTATCTTTCCTTATAACTCTGGG - Intergenic
1046095315 8:109552159-109552181 CTATCCTTCCTTGCAGCTAGGGG - Intronic
1050261848 9:3849213-3849235 ATATCCTTCCTTGGAAGTCGGGG - Intronic
1056089069 9:83186683-83186705 CTAGCCTACCTTGTAAATAGTGG + Intergenic
1057202067 9:93146274-93146296 CTAGCCTACCTTGTAAATAGTGG - Intergenic
1059250758 9:112886161-112886183 GTATACTTCCTTATAATTAGAGG - Intronic
1059612047 9:115909030-115909052 GTCTTCTGCCTTGAAACTAGGGG + Intergenic
1186284946 X:8033203-8033225 TTATCCTTCTGGGTAACTAGAGG + Intergenic
1187192182 X:17045654-17045676 GTAACCTTCCTTCTGACTAAAGG + Intronic
1187751169 X:22466555-22466577 GGAACCTTCCTTGGAAGTAGAGG - Intergenic
1190809991 X:53873900-53873922 GTTTTCTCCCTTGTAACCAGAGG - Intergenic
1190812949 X:53902312-53902334 GTTTTCTCCCTTGTAACCAGAGG + Intergenic
1192940298 X:75904472-75904494 CTATCCTTCCTTATAATTGGAGG - Intergenic
1194777838 X:97987722-97987744 GTATCCTTCCTGGGGACTGGTGG - Intergenic
1194885691 X:99313717-99313739 TTCCCCTTCCTTTTAACTAGGGG - Intergenic
1196745343 X:119066834-119066856 GTTTCCTTACTTGTAACCGGAGG - Intergenic
1197596764 X:128473202-128473224 GTCTCCATTCTTGTAACCAGTGG + Intergenic