ID: 978435252

View in Genome Browser
Species Human (GRCh38)
Location 4:108677022-108677044
Sequence GGGAACTTCCTTACCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978435249_978435252 21 Left 978435249 4:108676978-108677000 CCAAAATGAGGTGTGTTCTAACT No data
Right 978435252 4:108677022-108677044 GGGAACTTCCTTACCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978435252 Original CRISPR GGGAACTTCCTTACCTCTCA AGG Intergenic
No off target data available for this crispr