ID: 978443573

View in Genome Browser
Species Human (GRCh38)
Location 4:108759587-108759609
Sequence CATTAGGGACCTAGCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978443573_978443577 22 Left 978443573 4:108759587-108759609 CCAGAAAGGCTAGGTCCCTAATG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 978443577 4:108759632-108759654 AGAAACTCAGCAAACCCTTTTGG 0: 1
1: 0
2: 4
3: 17
4: 243
978443573_978443576 -3 Left 978443573 4:108759587-108759609 CCAGAAAGGCTAGGTCCCTAATG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 978443576 4:108759607-108759629 ATGTGTGATCACTTAGTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978443573 Original CRISPR CATTAGGGACCTAGCCTTTC TGG (reversed) Intronic