ID: 978443576 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:108759607-108759629 |
Sequence | ATGTGTGATCACTTAGTGAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 208 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 192} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978443573_978443576 | -3 | Left | 978443573 | 4:108759587-108759609 | CCAGAAAGGCTAGGTCCCTAATG | 0: 1 1: 0 2: 1 3: 5 4: 61 |
||
Right | 978443576 | 4:108759607-108759629 | ATGTGTGATCACTTAGTGAATGG | 0: 1 1: 0 2: 0 3: 15 4: 192 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978443576 | Original CRISPR | ATGTGTGATCACTTAGTGAA TGG | Intronic | ||