ID: 978443577

View in Genome Browser
Species Human (GRCh38)
Location 4:108759632-108759654
Sequence AGAAACTCAGCAAACCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978443575_978443577 6 Left 978443575 4:108759603-108759625 CCTAATGTGTGATCACTTAGTGA 0: 1
1: 0
2: 1
3: 7
4: 133
Right 978443577 4:108759632-108759654 AGAAACTCAGCAAACCCTTTTGG 0: 1
1: 0
2: 4
3: 17
4: 243
978443574_978443577 7 Left 978443574 4:108759602-108759624 CCCTAATGTGTGATCACTTAGTG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 978443577 4:108759632-108759654 AGAAACTCAGCAAACCCTTTTGG 0: 1
1: 0
2: 4
3: 17
4: 243
978443573_978443577 22 Left 978443573 4:108759587-108759609 CCAGAAAGGCTAGGTCCCTAATG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 978443577 4:108759632-108759654 AGAAACTCAGCAAACCCTTTTGG 0: 1
1: 0
2: 4
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978443577 Original CRISPR AGAAACTCAGCAAACCCTTT TGG Intronic