ID: 978443865

View in Genome Browser
Species Human (GRCh38)
Location 4:108762631-108762653
Sequence GGCAGGAAGCCCAGCGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978443855_978443865 13 Left 978443855 4:108762595-108762617 CCGCCGGCTGCAGAGCGAGCCGG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443853_978443865 22 Left 978443853 4:108762586-108762608 CCCGCTAGTCCGCCGGCTGCAGA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443854_978443865 21 Left 978443854 4:108762587-108762609 CCGCTAGTCCGCCGGCTGCAGAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443862_978443865 -6 Left 978443862 4:108762614-108762636 CCGGGGACTTTCGAGCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443852_978443865 23 Left 978443852 4:108762585-108762607 CCCCGCTAGTCCGCCGGCTGCAG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443859_978443865 10 Left 978443859 4:108762598-108762620 CCGGCTGCAGAGCGAGCCGGGGA 0: 1
1: 0
2: 0
3: 10
4: 176
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250
978443851_978443865 24 Left 978443851 4:108762584-108762606 CCCCCGCTAGTCCGCCGGCTGCA 0: 1
1: 0
2: 0
3: 7
4: 41
Right 978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG 0: 1
1: 0
2: 0
3: 28
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978443865 Original CRISPR GGCAGGAAGCCCAGCGTTCC GGG Intronic
900147064 1:1163012-1163034 GGCAGGAAGCTCACCCTTGCAGG + Intergenic
901825215 1:11856923-11856945 GGCAATCAGCCCAGCTTTCCAGG - Intergenic
902331698 1:15734114-15734136 GGCAGGATGCCCAGGGGTGCCGG - Exonic
902774786 1:18667743-18667765 GGCAGGTGGGCCAGAGTTCCTGG - Intronic
903316603 1:22512790-22512812 AGCATGAAGCCCAGGGTGCCAGG - Intronic
904688097 1:32274929-32274951 GGCAGGAAGCCTGGAGTTACAGG - Intronic
904852100 1:33467099-33467121 GACAGGAAGCCAGGCCTTCCAGG - Intergenic
906186014 1:43862569-43862591 GGAAGGAAGCCCAGAGTGCTGGG - Intronic
906192600 1:43907578-43907600 AGCAGGAAGCCGAGAGTTCTTGG - Intronic
907320667 1:53600150-53600172 TGCAGGAAGCCCACCGCCCCGGG - Exonic
907791934 1:57675087-57675109 AGCAGGAAGCCCAGAGATCCTGG + Intronic
908811366 1:67985228-67985250 GGTAGCAAGCCCAGTGTTGCTGG - Intergenic
910232180 1:84997749-84997771 GGCAGGAACCCCAGAGGGCCGGG - Intergenic
910280346 1:85493714-85493736 GGCAGCAGGTCTAGCGTTCCAGG - Intronic
910872207 1:91844975-91844997 GGCAGGTTGCCCAGGGTTTCAGG + Intronic
913196524 1:116460860-116460882 GTCAGGAAGCCCATCTCTCCAGG - Intergenic
914956075 1:152163849-152163871 GGAAGGAAGCCTAGGTTTCCTGG + Intergenic
915472700 1:156135367-156135389 GGCTGGAAGCCCAGGGTTGGGGG + Intronic
916280025 1:163040196-163040218 GGCAAGAAATCCAGGGTTCCAGG - Intergenic
919774430 1:201184915-201184937 GGCAGGGAGGTCAGCATTCCAGG + Intergenic
920091270 1:203455046-203455068 GGCAGGGAGGCCAGCGTTCAGGG - Intergenic
920269428 1:204752142-204752164 GGCAGGAACCCCAGCCTCCTGGG + Intergenic
920389735 1:205591967-205591989 GGCGGGAACCGCAGTGTTCCGGG - Intronic
920968254 1:210719911-210719933 GGAAGGAAGCCCAGTGGGCCAGG - Intronic
921292030 1:213667129-213667151 TTCAGGAAGCCCTGGGTTCCAGG - Intergenic
921890878 1:220352747-220352769 GGCAGGAAGCCTAGGGTTCATGG - Intergenic
922753807 1:228083093-228083115 AGCAGGAAGCCCAGGTTTCCTGG - Intronic
922764689 1:228150766-228150788 GGCAGTGAGCCCAGGATTCCTGG + Intronic
923336838 1:232978016-232978038 GGCAGGAGGCCCAGCTCTTCAGG - Intronic
1063098077 10:2925886-2925908 GGCAGGAAGCCCAGTTTGCAAGG + Intergenic
1064164142 10:12972366-12972388 AGCAGGAAACCCAGAGTGCCAGG - Intronic
1067057815 10:43062517-43062539 GTAAGGAAGCCCAGCGGTCCCGG + Intergenic
1067184396 10:44014741-44014763 TCCAGGAAGCCGAGGGTTCCTGG + Intergenic
1067345829 10:45438594-45438616 GCCAGGCAGCCCAGCATTCTAGG + Intronic
1068388262 10:56359911-56359933 GGAAGGAGGCCCAGTGTTGCAGG - Intronic
1069641170 10:69956403-69956425 GGCAAGAAGACAAGGGTTCCTGG - Intronic
1070684814 10:78472554-78472576 GGCAGGAAGCCCACAGTCGCTGG - Intergenic
1070877106 10:79825486-79825508 GGCATGAAACCCAGCGTGTCAGG + Intergenic
1071643601 10:87341530-87341552 GGCATGAAACCCAGCGTGTCAGG + Intergenic
1074246097 10:111695279-111695301 GGCAGGAAGCCATGAGTTACGGG + Intergenic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075007652 10:118842287-118842309 GGCAGGAGCCCCAGCCTCCCAGG + Intergenic
1075064708 10:119281648-119281670 GGCAGGTTGCCCTGGGTTCCCGG + Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1076197111 10:128526895-128526917 GGCAGGATGCCCAGGATTCATGG - Intergenic
1076669476 10:132111649-132111671 GGTGGGATGCCCAGCGGTCCAGG - Intronic
1078097613 11:8310343-8310365 GACCAGAAGCCCAGCTTTCCTGG + Intergenic
1079349910 11:19683664-19683686 GACTGGAAGCCCAGCCTTTCTGG - Intronic
1083779517 11:64910674-64910696 GCCTGGGAGCCCAGCGTACCAGG + Exonic
1084470757 11:69357658-69357680 GTCAGGAAGCCCAGCCTGCATGG + Intronic
1084977988 11:72813903-72813925 GGGAGGAATCCCCGCTTTCCGGG - Intergenic
1085171883 11:74456703-74456725 GGCAAGGAGACCAGAGTTCCTGG + Exonic
1086847742 11:91773294-91773316 TGCAAGAAGCACAGCGTTACTGG - Intergenic
1089228772 11:116950771-116950793 AGAAGGAAGCCCTGCGTTCTTGG + Intronic
1090069612 11:123532231-123532253 GGCAGGCAGCTCAGTGATCCAGG + Intronic
1090262035 11:125328146-125328168 GGGAGGAAGCCCTGCCTGCCTGG - Intronic
1091753207 12:3035362-3035384 GGCAGGAAGCCCAGCTGCCTGGG - Intronic
1091828784 12:3534702-3534724 GGCAGGAAGCCCAGTGTTGAGGG - Intronic
1095486470 12:42689824-42689846 GGCAGTAGGCACAGTGTTCCTGG + Intergenic
1095944826 12:47747925-47747947 GGCAGGATGCCCAGGGCCCCTGG + Intronic
1096839606 12:54372043-54372065 GGCAGGAAGCCCAGACTGGCTGG - Intronic
1099190352 12:79555138-79555160 AGCAGGAAGGCCAAAGTTCCAGG + Intergenic
1100600345 12:96107420-96107442 GGGCGGAAGCCCAGTGCTCCAGG - Intergenic
1104323942 12:127778154-127778176 GGTAGAAAGTCCAGGGTTCCTGG - Intergenic
1104509657 12:129365861-129365883 GGGGGGCAGCCCAGCCTTCCTGG + Intronic
1104965870 12:132508595-132508617 GGCAGCAAGGCGCGCGTTCCGGG + Intronic
1105060344 12:133144522-133144544 GGAAGAAAGCCCAGCTTACCCGG - Exonic
1105911200 13:24869599-24869621 GGCAGGAAACACAGCCTTCCAGG - Intronic
1105988272 13:25590979-25591001 TGCAGGCAGCCCAGAGTCCCAGG + Intronic
1106182535 13:27381360-27381382 GGTAGGAATCCCAATGTTCCTGG - Intergenic
1107559688 13:41547889-41547911 GACAGGCAGCCCAGCCCTCCTGG + Intergenic
1108021780 13:46135208-46135230 GGGAGAAAGCCCAGCAGTCCAGG + Intronic
1111512795 13:89287814-89287836 GGCAGGAAACCCACCCTCCCAGG - Intergenic
1112581545 13:100680347-100680369 GGAAGGAAGCACAGAGATCCGGG + Intergenic
1112783579 13:102927856-102927878 TGCAGGAAGCCCAGTGCTGCAGG - Intergenic
1113653718 13:112055760-112055782 GCCAGGCGGCCCCGCGTTCCAGG - Intergenic
1115648577 14:35386900-35386922 GGCAGGGCGTCCAGCATTCCCGG - Intergenic
1121338269 14:93090199-93090221 GGCAGGAAGCCCGGTGTGCTAGG - Intronic
1121486155 14:94316837-94316859 AGCAGGAGGCCCAGTGTTCAGGG - Intronic
1122291655 14:100683779-100683801 GGAAGAAAGCCCAGGGCTCCTGG + Intergenic
1122789560 14:104178603-104178625 GGCCGTAAGCCCAGCCTCCCCGG + Exonic
1122895844 14:104756532-104756554 GGCAGGTAGCCCGGCAGTCCCGG + Intronic
1124340732 15:28887694-28887716 GCCTGGAGCCCCAGCGTTCCAGG - Intronic
1124651597 15:31478077-31478099 GGCAGGAAGGCCTACGTCCCAGG + Exonic
1125202237 15:37110427-37110449 GGCAGGAGGCGCAGAGTTCGGGG + Intergenic
1125598470 15:40902503-40902525 GGCAGGATTCCCAGCACTCCTGG - Intronic
1125675513 15:41500411-41500433 GGCAGGAAGGCCAGCCTGGCAGG - Intronic
1125891934 15:43273581-43273603 TGAAGGAATTCCAGCGTTCCAGG + Intergenic
1128114055 15:65094456-65094478 GGCAGGAAGCCCTGCTGACCTGG + Exonic
1128232842 15:66047717-66047739 GGCAGGAGGCCCAGTGGGCCTGG + Intronic
1128735250 15:70049974-70049996 CGCAGGCAGCCGAGCGTTCAGGG - Exonic
1128916214 15:71565236-71565258 GGCAGGATGCTCAGCCTGCCAGG + Intronic
1129174524 15:73830412-73830434 GAGAGGAAGCCCAGCTCTCCTGG + Intergenic
1129769529 15:78194238-78194260 GGCTGGAAGCCCAGTGTGCTGGG - Intronic
1133315853 16:4883621-4883643 CGGAGGAAGCCCACCGTGCCGGG - Exonic
1133791768 16:9014490-9014512 GACAAGAAGCCCAGTGTGCCTGG - Intergenic
1137633739 16:49967442-49967464 GGCAGGATGCCCAGAGGACCAGG + Intergenic
1138460547 16:57145231-57145253 GGCAGGAAGCCCAGAGCTTGAGG - Intronic
1138541657 16:57691325-57691347 GCCAGGAGGCCCAGCCATCCAGG - Intergenic
1138925204 16:61581836-61581858 GGCAGGAAGCCCGCACTTCCGGG - Intergenic
1139390909 16:66605678-66605700 GGCAGGAAGCGCCAAGTTCCTGG - Intronic
1139420536 16:66846972-66846994 GGCCTGAAGCCCAGAGATCCTGG + Intronic
1140846423 16:78892999-78893021 AGCAGGAAGCCCAGCTTCTCTGG + Intronic
1140958054 16:79885719-79885741 GGCAGGAAGCCCACTGCTCGGGG - Intergenic
1141696937 16:85624611-85624633 GGAAGGAAACCCAGCTGTCCTGG - Intronic
1142324747 16:89407395-89407417 GGGAGGCAGCCCAGTGTTGCTGG - Intronic
1142579062 17:929540-929562 GACAATAAGCCCAGCCTTCCTGG - Intronic
1143012953 17:3876267-3876289 GGCGGGAACCCCAGCATTCATGG - Exonic
1144767397 17:17740132-17740154 GGCACTAAGCCCAGAGTCCCAGG - Intronic
1145755270 17:27385667-27385689 GGAAGTAAGCCCAGAGCTCCTGG - Intergenic
1147609218 17:41791901-41791923 GGCAGGAATTCCAGAGTTTCTGG - Intergenic
1147667831 17:42159957-42159979 GGCAGGAAGCCAAGGGGCCCAGG + Exonic
1149874266 17:60215256-60215278 GCCACCAAGCCCAGCCTTCCAGG + Intronic
1150088052 17:62292507-62292529 GCCACCAAGCCCAGCCTTCCAGG + Intergenic
1150952674 17:69821213-69821235 GGCAGGAGGCCCACCCTCCCAGG + Intergenic
1151129660 17:71883254-71883276 GGCAGGCAGACCAGGGTGCCTGG + Intergenic
1151478233 17:74355527-74355549 GCCAGGGAGCCCAGCCGTCCTGG - Exonic
1151598960 17:75094723-75094745 GGCAGGAGCCCCAGCTCTCCCGG + Intronic
1152354513 17:79800230-79800252 GGGAGGAAGCCCTGTGTTCCGGG + Intronic
1152530223 17:80914351-80914373 GGCAGGAACCCCACCCTCCCAGG + Intronic
1154300003 18:13184575-13184597 GGCAGGTGGCCCAGCGTCCCCGG - Intergenic
1155434367 18:25796008-25796030 GGCAGGCAAACCAGCATTCCAGG + Intergenic
1156448987 18:37255926-37255948 GGGCAGAAGCCCAGCCTTCCTGG + Intronic
1156469982 18:37371386-37371408 GGCCAGAAGCCCAGGGATCCTGG + Intronic
1160091171 18:75827889-75827911 GGCAGGAGGCCCAGGGTGCGAGG + Intergenic
1160357566 18:78241038-78241060 GACAGTGAGCCCAGCATTCCTGG + Intergenic
1160556267 18:79727319-79727341 GGTGGGAAGCACAGCGTTCGCGG + Intronic
1160969584 19:1761616-1761638 GGCAGGTAGCCCGGCTTACCCGG + Intronic
1161704021 19:5809698-5809720 GGCAGAAAGCCCAGAGTGCCCGG - Intergenic
1162747693 19:12807989-12808011 GGCTGTAATCCCAGCGTTTCAGG + Intronic
1164120509 19:22261631-22261653 CGCAGGAACCCCCGCCTTCCAGG - Intergenic
1165489036 19:36112799-36112821 AGCGGGCAGCCCAGCGTCCCAGG - Exonic
1165601421 19:37058234-37058256 GTATGGAAGCCCAGAGTTCCAGG - Intronic
1165631507 19:37305513-37305535 GGCAGGAAGCCCGGAGCTCTGGG - Intergenic
1165862285 19:38915624-38915646 GCCAGGCAGCCCAGGCTTCCGGG + Exonic
1166045040 19:40224970-40224992 GGAACGAAGCCCAGAGTTCTAGG - Intronic
1166937056 19:46340247-46340269 GGCAGGAAGCCCAGAGCGCAAGG - Exonic
1167493529 19:49805373-49805395 GTCAGGAACCCCAGAGCTCCCGG - Intronic
1168230258 19:55026920-55026942 GGCAGGAAGCCCTGGGCTACAGG - Intronic
1168230278 19:55026974-55026996 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230298 19:55027028-55027050 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230318 19:55027082-55027104 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230338 19:55027136-55027158 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230358 19:55027190-55027212 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230378 19:55027244-55027266 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230396 19:55027298-55027320 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230433 19:55027406-55027428 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230453 19:55027460-55027482 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168589084 19:57617851-57617873 GGCAGGTGGCAAAGCGTTCCAGG + Intronic
925715585 2:6781677-6781699 GGTAGGGAGCCCAGCTTTGCTGG - Intergenic
925741376 2:7008440-7008462 GGCAGGAAGGCCAGTGTGACCGG - Intronic
928914464 2:36456610-36456632 GGCAGGGAGCCTTCCGTTCCTGG + Intronic
929559569 2:42947544-42947566 GGCAGGCAGCCTAGAGTTTCAGG + Intergenic
930735397 2:54773472-54773494 GGAAGAAAGCTCAGCCTTCCAGG - Intronic
931983431 2:67718821-67718843 GGCAGGGAGACCAGTGTTCCAGG - Intergenic
933997290 2:87679287-87679309 GGCAGGAGGCCCAGGGTTGTTGG - Intergenic
935157561 2:100496795-100496817 GGCAGGAATCCCAACGTTCTAGG + Intergenic
935381359 2:102453998-102454020 GGCAGGAAGGCCAGGGATCCTGG - Intergenic
936296562 2:111271623-111271645 GGCAGGAGGCCCAGGGTTGTTGG + Intergenic
936745589 2:115573252-115573274 TGCATGAAGCCCAGGCTTCCTGG + Intronic
937653807 2:124351409-124351431 GGCAGGAAGACCAGCCAGCCTGG + Intronic
938018115 2:127885098-127885120 GGCATGAAACCCAGCGTGTCAGG + Intronic
943746123 2:191464223-191464245 GGCAGGCAGGCCAGCCATCCTGG + Intergenic
944762542 2:202831848-202831870 GGCAGGAAGCCAAGTCTTACTGG + Intronic
945443974 2:209913955-209913977 GGCAGCAGGCACAGGGTTCCAGG - Intronic
946200239 2:218067369-218067391 GGCAGGCAGCCCAGATGTCCGGG + Intronic
946638942 2:221762564-221762586 GGCAGGAAGCACTGGGTACCTGG - Intergenic
947605602 2:231483535-231483557 GGCAGGAAGCCCTGGGTAGCGGG + Intronic
948648933 2:239426764-239426786 GGTGGGAAGCCCAGCGCTGCAGG + Intergenic
948866476 2:240777572-240777594 GGATGGAAGGTCAGCGTTCCAGG - Intronic
1169321615 20:4637429-4637451 CTCAGGAAGCCCAGGGCTCCAGG - Intergenic
1171846862 20:30282743-30282765 TGCAGGGAGGCCAGCGTTCCAGG - Intergenic
1171847454 20:30285587-30285609 TGCAGGGAGGCCAGCGTTCCAGG + Intergenic
1172878062 20:38178131-38178153 GGCAGGGAGGCCAGCGTGCCGGG - Intergenic
1174083185 20:47985220-47985242 GGAAGGAAGCCCAGGCCTCCTGG + Intergenic
1174699196 20:52590599-52590621 TGGTGGAAGCCCAGGGTTCCAGG - Intergenic
1175443318 20:59005324-59005346 GGCACAAAGCCCAGGCTTCCGGG + Intronic
1175547408 20:59787403-59787425 GGAAGGAAGCCCAGCCTTTGAGG + Intronic
1176218357 20:63958646-63958668 GGCAGGGAGTCCAGGGTGCCTGG - Exonic
1177183120 21:17765050-17765072 GACAGGAAGACCAGCCTTCATGG + Intergenic
1177276193 21:18915635-18915657 GTCAGGAAGCCCAGCAACCCGGG - Intergenic
1178006525 21:28226791-28226813 GGCAGGCAGCCCAGGCTTCCAGG - Intergenic
1178378629 21:32089955-32089977 GGCAGGAGGCCCAGGGTCGCAGG - Intergenic
1178479389 21:32966640-32966662 TCCCGGAAGCCCAGCATTCCGGG + Intergenic
1178486288 21:33021736-33021758 GGCTGTCAGCCCAGCTTTCCAGG + Intergenic
1178991190 21:37358142-37358164 GGATGGAAGCCCAGCTTTCCAGG - Intergenic
1179310928 21:40195736-40195758 GGCAGGAATTACAGGGTTCCCGG + Intronic
1180993109 22:19950587-19950609 GGCAGGAAGCCTAAAGTTCCAGG + Intronic
1183100769 22:35582726-35582748 GGCAGGATGCCCAGAGATCTGGG - Intergenic
1183829626 22:40410893-40410915 GGCAGGGAGCCCTGGGATCCTGG + Exonic
1185282825 22:49983034-49983056 GGCAGGCTGCCCAGCGGGCCGGG - Intergenic
950481477 3:13246957-13246979 GGCAAACAGGCCAGCGTTCCAGG - Intergenic
950672617 3:14536351-14536373 GTCAGGGAGCCCTGGGTTCCAGG - Intronic
953158288 3:40394830-40394852 GGCAGGCAGCCCAGCTATCAGGG - Intronic
953740917 3:45538250-45538272 ATGAGGAAGCCCAGCCTTCCTGG - Intronic
953850662 3:46463690-46463712 GGAAGGAAGCCTTGCCTTCCTGG - Intronic
953877774 3:46676246-46676268 TGTAGGCAGCCCAGAGTTCCTGG + Exonic
954376000 3:50194410-50194432 AGCGGGAAGCCCCGCGTGCCCGG + Intronic
954932443 3:54295981-54296003 GGTAGGGAGCCCAGGGTGCCTGG + Intronic
956678253 3:71754590-71754612 AGCAGGAAGCCCAGCGCGCCGGG - Exonic
961165829 3:124763280-124763302 GGCTGGGGGCCCAGCATTCCTGG + Exonic
965211690 3:165797753-165797775 GGCAGCAAGCCCACAGTTTCAGG + Intronic
966132026 3:176651927-176651949 GGCAGGTAGCCAAGCCATCCTGG - Intergenic
975144039 4:70947866-70947888 GGCAGTAATCCCAGCATTCTGGG - Intronic
976059734 4:81113111-81113133 GGCAAGAAGGCCAGCGTGGCTGG + Intronic
978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG + Intronic
978624712 4:110671785-110671807 GCCAGGCAGCCCTGCGTTCTAGG + Intergenic
980901859 4:138912651-138912673 GGCAGGGAGCCCAGCCTCCAGGG + Intergenic
984916532 4:184730126-184730148 AGCTGGAAGCCCAGAGTGCCTGG - Intronic
985253417 4:188045182-188045204 GCCAGGAAGACCAGAGTCCCTGG - Intergenic
986047161 5:4050289-4050311 GGAAGGCAGCCCTGCATTCCGGG + Intergenic
986760418 5:10875267-10875289 GGCTGGAAGCCCAGCTCTGCAGG + Intergenic
987823230 5:22992321-22992343 TGCAGGAACCACAGCGTTACTGG + Intergenic
990512428 5:56500691-56500713 GGCAGGAAGCCTAGAATTCAGGG + Intergenic
991291336 5:65035937-65035959 GCCAGGGAACCCAGCGTTCGAGG - Intergenic
994450070 5:99930009-99930031 GGCAGGAATCCCACCCTACCAGG - Intergenic
998204750 5:140150396-140150418 GGCAGGCAGCCCTGCCTACCAGG - Intergenic
998912423 5:146974468-146974490 GGCAGCAAGCCCAGTGATTCAGG - Intronic
1002212737 5:177608369-177608391 GGCAGGAAGCAGCGCGTCCCGGG - Intronic
1002417777 5:179129844-179129866 GTCAGGAGGCTCAGCGTCCCAGG + Intronic
1006319761 6:33313527-33313549 GGCTGGAAGGGCAGCGTTCGGGG + Intronic
1007424444 6:41737645-41737667 GGCAGGAGACCCAGCATTTCTGG + Intronic
1008231496 6:48989683-48989705 GGCAGGAACCCCACCCTCCCAGG + Intergenic
1008658742 6:53643985-53644007 TGCAGGAAGATCAGGGTTCCAGG - Intergenic
1011054809 6:83193549-83193571 GGCGGCAGGCCCTGCGTTCCTGG + Intronic
1011822727 6:91271947-91271969 GGCAGGAACCCCAGGCTCCCAGG - Intergenic
1013191036 6:107804322-107804344 GGCAGGATGCCCATAGTTACTGG + Intronic
1015167327 6:130212654-130212676 GGAAGGAAGCCCAGGTTTCCTGG + Intronic
1016167616 6:140966569-140966591 GGCAGGACCCCCAGAGGTCCAGG + Intergenic
1017054366 6:150424372-150424394 GGCAGGAACCCCACCTTCCCAGG + Intergenic
1017072170 6:150585088-150585110 GGGAGGAAGCAGAGTGTTCCAGG - Intergenic
1018373309 6:163187728-163187750 GGGAGGAACCCCAGCATCCCAGG + Intronic
1018376364 6:163217361-163217383 GACAGGAAGGCCAGGGTTCCAGG + Intronic
1018600882 6:165539660-165539682 GGCTGCAAGCCCAGCGCTCCGGG + Intronic
1019614061 7:1950965-1950987 GGCACGAAGCCCATGCTTCCTGG + Intronic
1019636832 7:2080571-2080593 GGTAGGAAGCCCAGGATTCCGGG + Intronic
1021241061 7:18201587-18201609 GGCAGGAGGCCCTTGGTTCCTGG - Intronic
1024969077 7:55052251-55052273 GGCAGGAAGCTGACCCTTCCTGG - Intronic
1025936836 7:66044442-66044464 GGCATGAAGCGCGGCGCTCCTGG - Intergenic
1026415211 7:70172288-70172310 GGCAGGAAATACAGCTTTCCAGG + Intronic
1028068267 7:86415468-86415490 TGAAGGAAGCGAAGCGTTCCAGG - Intergenic
1029476751 7:100789548-100789570 GCCAGAAATCCCAGCGCTCCGGG + Intronic
1032164684 7:129536305-129536327 GGCAAGAAGTCCTGAGTTCCTGG - Intergenic
1032237889 7:130140746-130140768 GGCGGGTAGCCCAGCGCACCGGG - Intergenic
1033245674 7:139714660-139714682 GGCAGGAAGACCGGGGTCCCCGG - Intronic
1034075487 7:148227165-148227187 TGCTGGAAGCCAAGTGTTCCCGG + Intronic
1034315626 7:150128964-150128986 GACACAAAGCCCAGAGTTCCAGG + Intergenic
1034432109 7:151046213-151046235 GGCAGGAAGCAGAGAGCTCCAGG - Intronic
1034724094 7:153319337-153319359 GGCGGGAAGACCAGCCTTCCTGG + Intergenic
1034791263 7:153971841-153971863 GACACAAAGCCCAGAGTTCCAGG - Intronic
1035160597 7:156947635-156947657 AGCAGGACCTCCAGCGTTCCTGG + Intergenic
1037581181 8:20246876-20246898 GGCAGGAAGCCCACCCTGTCTGG + Exonic
1037819098 8:22127181-22127203 GGCAGGCAGCCCCGAGGTCCAGG - Exonic
1037890309 8:22620606-22620628 AGCAGGCAGCCCAGCATGCCAGG - Exonic
1038608293 8:29033167-29033189 GGAAGGAAGACCAGCTTGCCAGG - Intronic
1039720246 8:40156732-40156754 GGAATGAAGGCCAGAGTTCCTGG - Intergenic
1040895744 8:52366479-52366501 AGCAGGAAGCCCAGCATTATTGG - Intronic
1043401682 8:79891218-79891240 GTCAGGAAGCCAAGCGGCCCGGG + Intergenic
1045486067 8:102632793-102632815 GCCAGGAAGCTCAGGCTTCCAGG - Intergenic
1048063115 8:130941235-130941257 GGCAGGAAGACCAGGCTTCCAGG - Intronic
1049562417 8:143318347-143318369 GGCAGGTGGCCCAGAGTCCCCGG + Intronic
1049707103 8:144048068-144048090 GGCAGGAAGCTCAGCAGCCCAGG - Intergenic
1049823882 8:144654746-144654768 AGGAGGAAGCCCAGCCCTCCTGG + Intergenic
1053481273 9:38418231-38418253 GGCAGGAAGGACAGCGTGGCAGG + Intronic
1053784553 9:41644970-41644992 TCCAGGGAGGCCAGCGTTCCAGG - Intergenic
1054448138 9:65387992-65388014 TCCAGGGAGGCCAGCGTTCCAGG - Intergenic
1056930433 9:90871752-90871774 GGCAGGGAGCCCAGGGATCTGGG + Intronic
1057716965 9:97502621-97502643 GGCTGGGACCCCAGCGTCCCAGG - Intronic
1060214125 9:121728144-121728166 GGCAGGAGGCCCTGGGTTCTAGG + Intronic
1060618725 9:125043901-125043923 GGGTGGGAGCCCAGCGCTCCTGG + Intronic
1061714403 9:132509860-132509882 CCCAGGAAGCCCAGCCTCCCTGG + Intronic
1062342357 9:136099471-136099493 GACAGGAAGCCGAGCCTGCCAGG + Intergenic
1188028654 X:25238916-25238938 AGCAGGAAGCCCAGAATTCCTGG - Intergenic
1189127147 X:38460821-38460843 GGCAGGAACCCCAGCCTTCTAGG + Intronic
1197724701 X:129768650-129768672 GCCAAGAAGCCCTGTGTTCCTGG - Exonic
1199597967 X:149522997-149523019 GGCGGGATGCCCAGAGCTCCTGG - Intronic
1199643475 X:149883965-149883987 AGCAGGAACCCCACAGTTCCTGG + Intronic
1200093446 X:153646618-153646640 GGCTGGGAGCTCAGGGTTCCTGG + Intronic
1200105469 X:153709696-153709718 GCCAAGAAGCCCAGCTTTTCAGG - Intronic