ID: 978446736

View in Genome Browser
Species Human (GRCh38)
Location 4:108787474-108787496
Sequence ACCTGGATCCTGCCTCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978446736_978446744 24 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446744 4:108787521-108787543 CGTCTTGCACAAGGCTGGTATGG No data
978446736_978446741 15 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446741 4:108787512-108787534 ACCAAAGCACGTCTTGCACAAGG No data
978446736_978446746 30 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446746 4:108787527-108787549 GCACAAGGCTGGTATGGAAAGGG No data
978446736_978446743 19 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446743 4:108787516-108787538 AAGCACGTCTTGCACAAGGCTGG No data
978446736_978446739 -10 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446739 4:108787487-108787509 GGATCCAGGTAGGAGAGAAAAGG No data
978446736_978446745 29 Left 978446736 4:108787474-108787496 CCCGTGAGAGGCAGGATCCAGGT No data
Right 978446745 4:108787526-108787548 TGCACAAGGCTGGTATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978446736 Original CRISPR ACCTGGATCCTGCCTCTCAC GGG (reversed) Intergenic
No off target data available for this crispr