ID: 978447054

View in Genome Browser
Species Human (GRCh38)
Location 4:108789651-108789673
Sequence ACCTTGGCCTTGAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 2, 2: 2, 3: 16, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978447054_978447061 17 Left 978447054 4:108789651-108789673 CCAGTTTCCCTCAAGGCCAAGGT 0: 1
1: 2
2: 2
3: 16
4: 186
Right 978447061 4:108789691-108789713 CTGCAGATACGATCACTTTGTGG 0: 1
1: 0
2: 3
3: 51
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978447054 Original CRISPR ACCTTGGCCTTGAGGGAAAC TGG (reversed) Intergenic
901456749 1:9367540-9367562 AGGTAGGCCTTGAGGGAAGCCGG - Exonic
903543052 1:24107647-24107669 TCTCTGGCCTTGTGGGAAACTGG + Intronic
904375627 1:30080503-30080525 CCCTTGGCCCTGGGAGAAACTGG + Intergenic
905220941 1:36447012-36447034 GCCTTGGCCTTGTGGGAACAGGG + Intronic
905341816 1:37283387-37283409 ACCTGGGCCTTTAGGGAGGCAGG + Intergenic
906167421 1:43697273-43697295 AACTTGCCCTTGATGCAAACAGG - Intronic
907274551 1:53310072-53310094 ACCCTGGCCTTCAGGGGGACAGG + Intronic
907706324 1:56835663-56835685 CCCTTGGCCATGAAGGAAAAGGG + Intergenic
909053063 1:70790719-70790741 ACCTTTGCCTTAAGGGAAGTGGG - Intergenic
909375719 1:74939518-74939540 ACCTTGGCCTTCTGGGTAGCTGG - Intergenic
911730459 1:101287311-101287333 ACCTTAGCCTCCAGGGTAACTGG - Intergenic
912260745 1:108109773-108109795 CCCTAGGCCTTGTGGGAAATGGG + Intergenic
912641727 1:111352472-111352494 ACCTTGGCCTTTAAGGAATTAGG - Exonic
913457469 1:119048520-119048542 ATGTTGCCATTGAGGGAAACTGG - Intronic
914322227 1:146576266-146576288 AGCTTGGCCAAGAGGGAAAAAGG + Intergenic
914415036 1:147471749-147471771 AGACTGGCCTTGAGGGAAACAGG + Intergenic
916079556 1:161223880-161223902 TCCTTGGACTTGAGTGCAACAGG + Intergenic
916949553 1:169765478-169765500 ACATTGTCATTGAGGGAAACTGG + Intronic
918309841 1:183278068-183278090 GACTTGGCATTGAGGGAACCAGG - Intronic
924545086 1:245019149-245019171 ACCGAGGCCCTGAGGGAAAGTGG + Intronic
1063273145 10:4534619-4534641 ACCTCGGCCTTCAGAGAAGCTGG - Intergenic
1064190152 10:13198843-13198865 ACCTTGGCTTTGAAGGACATCGG - Intronic
1064559001 10:16577257-16577279 CCCCTGGCCTGGAGGGAAGCTGG + Intergenic
1064641667 10:17421301-17421323 ACAATGCCCATGAGGGAAACAGG - Intronic
1065226781 10:23551503-23551525 CCCTAGGCCTTGGTGGAAACAGG + Intergenic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1069754100 10:70762659-70762681 AACTTGGGCCTCAGGGAAACAGG - Intergenic
1072595902 10:96871525-96871547 ACCTTAGCCTTGAGAGTAGCTGG + Intronic
1074622076 10:115136111-115136133 ACCTTGGCCTTTAGAGTAGCTGG + Intronic
1075923869 10:126235254-126235276 ACCACGGCCTTGAGGGAGAGTGG + Intronic
1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG + Intronic
1079133466 11:17762897-17762919 ACCTTGGGCTTGTGGAAACCTGG - Intronic
1082001139 11:47394351-47394373 ACCTTGGCAGAGAGGGGAACAGG - Intergenic
1082076394 11:47979425-47979447 AGCTTGGCCTTCGGAGAAACAGG - Intergenic
1083393450 11:62372249-62372271 ACCTTGGCCTTGACGGAAACGGG + Intronic
1085442132 11:76574964-76574986 CCCATGCCCTTGAGGGTAACAGG + Intergenic
1085514451 11:77104242-77104264 CCCTTTGCCTTGAGGGAAGTTGG + Intronic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1087157667 11:94920824-94920846 ATCTTGGCTTTAAGGGAAATGGG + Intergenic
1094483864 12:30908395-30908417 ACATTACCATTGAGGGAAACTGG + Intergenic
1096605573 12:52763231-52763253 GACTTGGCCATGAGGGTAACAGG + Intergenic
1098075774 12:66729135-66729157 ACCTTGGCCTCCAGGGTAGCTGG + Intronic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1099979707 12:89584294-89584316 ATCCTGGCCTTGAGGGACATAGG - Intergenic
1101027345 12:100624120-100624142 ACCTTGGCCTTGGGGGTATTGGG - Exonic
1103062603 12:117870850-117870872 GCCTTGCCCTTGAGGCAAAAGGG + Intronic
1103313370 12:120030876-120030898 ACCCATGCCTTGAGGCAAACTGG - Intronic
1104144960 12:126024353-126024375 ACCTTGGCCTCCAGGGTAGCTGG - Intergenic
1110516252 13:76416089-76416111 ACATTGCCCTAGAGGGAAATAGG + Intergenic
1111665381 13:91261262-91261284 ACCATTGCCTGGAGGGAAATGGG - Intergenic
1112492138 13:99876696-99876718 ACCTTGGCTGTGAGTGATACTGG - Intronic
1113076145 13:106469737-106469759 AGCTGGGCCTTGGGAGAAACAGG + Intergenic
1114064268 14:19047555-19047577 ACCTGGGCCTTGAGGAATCCTGG - Intergenic
1114097991 14:19352443-19352465 ACCTGGGCCTTGAGGAATCCTGG + Intergenic
1114822781 14:26041646-26041668 ACCTTGGCTCTGAGTGAAATTGG + Intergenic
1116864557 14:50021010-50021032 ACCCTGGCTGTGAGGGAATCTGG - Intergenic
1118458147 14:65963381-65963403 ACCTTGCCCTTCAGGGAAAGGGG + Intronic
1119111928 14:71982909-71982931 ACATTGGCCTTGAGAGAAGGTGG + Intronic
1121558674 14:94857944-94857966 ACCTTGGCCTTGAGTCCACCCGG - Intergenic
1122055872 14:99097990-99098012 ACCTTGGCCTTCAGTGAATGGGG - Intergenic
1123815150 15:23970570-23970592 ATCTTGGCCTGGACGGAAATTGG + Intergenic
1124896706 15:33784266-33784288 TCCTTGGCCTTAAGGAACACTGG - Intronic
1127858711 15:62974775-62974797 ACCTGGCCCTTGAGGCACACAGG + Intergenic
1130136191 15:81183789-81183811 ATCTTGGCTCTGAGGGTAACAGG + Intronic
1130388712 15:83435911-83435933 ACATTGGCCTGGAGAGAACCAGG - Intergenic
1131070048 15:89460559-89460581 ACCTTCACCTTGAGGGAGCCTGG + Intergenic
1131419340 15:92291172-92291194 ACCTGGGCCTTGAAGGACAGGGG - Intergenic
1132727307 16:1344541-1344563 ACCCTGGCCATGAGGGGTACGGG + Intronic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1133089134 16:3389979-3390001 ACCTTGACCTGGAGGGAAGATGG + Intronic
1135125919 16:19809181-19809203 ACTTTGCCCTGGAGGGAAACTGG - Intronic
1135131993 16:19860806-19860828 ACACTGGCCTTGAAGGAACCAGG + Intronic
1135676765 16:24421727-24421749 ACATTACCCTTGAGGGAAGCTGG + Intergenic
1136057208 16:27699229-27699251 ACCTTGTCCTTGAGAGAAGCAGG - Intronic
1136379160 16:29883959-29883981 ACCTTGGCCTTAAAGGATAGAGG - Intronic
1139828320 16:69775366-69775388 ACCTTGGCATTTAAGAAAACAGG - Intronic
1140011399 16:71134902-71134924 AGCTTGGCCAAGAGGGAAAAAGG - Intronic
1146527101 17:33576429-33576451 ACCTTGGCCAGGAGGGAATGAGG - Intronic
1148850643 17:50553375-50553397 ACCAAGGCCTGGAGGGAAAGAGG + Intronic
1149257325 17:54841488-54841510 ACCTTACCATTGAGAGAAACTGG + Intergenic
1151346182 17:73503219-73503241 ACCATGGCCATGAAGGACACTGG + Intronic
1151838207 17:76598157-76598179 ACCTAGGCCTTGAGAAAGACTGG + Intergenic
1151904318 17:77037810-77037832 TCCCTGACCTTGAGGGAAAGAGG + Intergenic
1151950541 17:77351301-77351323 ACCTAGGCCTGGCAGGAAACCGG + Intronic
1152612969 17:81324488-81324510 AGCTTGGCCTTGTGGGTAAATGG + Intronic
1153781617 18:8500051-8500073 ACCTTGGCCTGCTGGGAGACAGG + Intergenic
1154975618 18:21454741-21454763 CCCTTGACCTTGAGGGAAAAAGG - Intronic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1159425146 18:68275418-68275440 ACATTACCCTTCAGGGAAACTGG + Intergenic
1159752701 18:72322662-72322684 ATCTTGTCCTTGATAGAAACTGG + Intergenic
1163766432 19:19165872-19165894 ACCTTGACCTTGGGTGAAACTGG + Intronic
1164931616 19:32180095-32180117 GCCTTGGCCTCCAGAGAAACTGG - Intergenic
1167605699 19:50480441-50480463 AACTTGGGCCTGAGGGTAACAGG + Intronic
928670889 2:33602274-33602296 TCATTGGCCTTGAGGAAGACAGG + Intergenic
930016002 2:46970903-46970925 GCCTTGGCCTGGAGGAAAGCGGG - Intronic
931351371 2:61491783-61491805 ACCTTGGCCTCGTGGGTAGCTGG - Intronic
932446117 2:71782597-71782619 AGATTGGCCTAGAGGGACACAGG - Intergenic
938806639 2:134812391-134812413 ATTTTGGCATGGAGGGAAACTGG - Intergenic
939475830 2:142685660-142685682 ACATTGGACTTGAGGTATACAGG + Intergenic
944457168 2:199907685-199907707 AACTGGGCCTTGAGAGGAACAGG - Intergenic
945402428 2:209401488-209401510 CCATTGGCCTTGGGGAAAACTGG + Intergenic
947726276 2:232402770-232402792 GCCTGGGGCTTGAGGTAAACAGG + Intergenic
948185280 2:236016522-236016544 TCCTTAGCCTTGAGGGCAAATGG + Intronic
1169447715 20:5686456-5686478 ACCTTGGCCTTCAGAGTAGCCGG - Intergenic
1170880392 20:20291978-20292000 ACCCTGTCCTTGAGGAAATCTGG - Intronic
1171260270 20:23725867-23725889 AGCTTGGCCTTTAGAGAAGCTGG + Intergenic
1171269383 20:23801689-23801711 AGCTTGGCCTTTAGAGAAGCTGG + Intergenic
1172655017 20:36531598-36531620 GCCTAGTCCTTGAGGGAACCAGG + Intergenic
1172925832 20:38534022-38534044 ACCTTGGCCTCCAGAGTAACTGG - Intronic
1173688101 20:44938171-44938193 ACCTTGGCATGGAGGGATTCTGG - Exonic
1173800819 20:45893290-45893312 ACCATGGCCTTCTGGGGAACAGG + Exonic
1174302342 20:49591841-49591863 TGCTTGGGCTTGAGGGAACCAGG + Intergenic
1175758903 20:61547974-61547996 CCCTTGGCCTTGAGGGGAGGGGG + Intronic
1177476259 21:21627818-21627840 AAGTTGGCTTTTAGGGAAACTGG - Intergenic
1178550505 21:33534325-33534347 ACCTTGGCCTTTAGAGGAGCTGG + Intronic
1180482759 22:15770181-15770203 ACCTGGGCCTTGAGGAATCCTGG - Intergenic
1181025980 22:20127924-20127946 ACCCTGGCCTTGGAGAAAACTGG + Intergenic
1181133459 22:20748335-20748357 GCCTTGGCCTTGCGGTCAACAGG + Intronic
1181264092 22:21620170-21620192 ACCTTGGCCTTGAGAGTAGTTGG - Intronic
1181971387 22:26692920-26692942 ACCTTGGCCTTGAGACCATCAGG + Intergenic
1183507904 22:38219712-38219734 ACTTTGGCCTGGAGGGAGAAGGG + Exonic
1184001115 22:41674315-41674337 ACCATGCCCTTGAGGGTAGCAGG - Exonic
1184352121 22:43951505-43951527 AGCTTGGCTGTGAGGGAAGCAGG - Intronic
950728014 3:14931436-14931458 GCCTTGGCCTTGAGTGTAGCTGG + Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
952178301 3:30891219-30891241 AGCTTGGCTCTGAGGGAAAAGGG - Intronic
954830883 3:53420444-53420466 ACCTTGGCCTATAGGGTAAAAGG - Intergenic
958433644 3:94071885-94071907 ACCTGGGGCTGGAGGGAAAGTGG - Intronic
960942106 3:122941825-122941847 ATGTTAGCCTTGGGGGAAACTGG + Intronic
961417133 3:126767318-126767340 ACCTTGGCCTTGATGGAAATGGG - Intronic
962254896 3:133863952-133863974 AACTTGGCCTTCAGGGCACCTGG + Intronic
962363847 3:134764141-134764163 TACTTGGCATTGAGGCAAACTGG - Intronic
964132576 3:153306514-153306536 ACCATGGCCCTGAGGGTATCGGG - Intergenic
964930429 3:162014506-162014528 ACATATGCCTTGAGGGAAATAGG - Intergenic
967821165 3:193840637-193840659 ACCTTAGCCTTCAGGGTAACTGG + Intergenic
969610645 4:8225936-8225958 ACCCTGGCCTTGGGGGCAGCTGG - Intronic
972830784 4:42811470-42811492 ACCTTGGCCTTGGTGGGAAGAGG + Intergenic
973856754 4:55019281-55019303 ACCTTCTCCTAGAGGGAAACTGG + Intergenic
975268893 4:72405761-72405783 GACTTGGCCTTGAAGGGAACTGG - Intronic
978447054 4:108789651-108789673 ACCTTGGCCTTGAGGGAAACTGG - Intergenic
981547716 4:145911167-145911189 TTCTTGGCCTTTGGGGAAACTGG - Intronic
984581259 4:181512294-181512316 ACCTTGGCCTCAAGGGAACGTGG - Intergenic
984855223 4:184189295-184189317 ACTTTGTCCCTCAGGGAAACTGG + Intronic
985548823 5:523208-523230 ACCTTGGCCTTGGTGGAACCTGG - Intronic
988274767 5:29066988-29067010 ACCTTGACCTTGAGGCACACAGG + Intergenic
991916709 5:71612829-71612851 ACCTTTGCCTTGTGGGTAGCTGG + Intronic
994776813 5:104045172-104045194 AACTTGGAATTGAAGGAAACTGG - Intergenic
997359476 5:133285573-133285595 CCCTTGGCCTTGGAGGAAACAGG - Intronic
1001636042 5:173211165-173211187 GGCTTGCCCTTGAGGGCAACGGG + Intergenic
1001784097 5:174396827-174396849 ACCAGGGCCTTGAAGGATACAGG + Intergenic
1002137612 5:177117531-177117553 ACCTCGGCCTCCAGGGTAACTGG - Intergenic
1002457890 5:179356131-179356153 ACCTTGGCCTTGCTGGACCCTGG + Intergenic
1003133398 6:3414686-3414708 ATCTTGGCCTTGAGGAAATAAGG - Intronic
1005148698 6:22722570-22722592 ACCTTGGCCTTCAGAGTAGCTGG - Intergenic
1005874462 6:30000470-30000492 AACCTGTCCCTGAGGGAAACTGG + Intergenic
1006100427 6:31683012-31683034 CCGTGGGCCTTGAGGGAACCGGG + Intronic
1006301421 6:33195325-33195347 GCCTTGGCCTTGAGAGACAAAGG + Intronic
1008487279 6:52050090-52050112 TTGTTGGCCTTGAGGGACACAGG - Intronic
1008886120 6:56432827-56432849 ACCTTGGCCTTGACGAAAACGGG - Intergenic
1010844728 6:80690978-80691000 ACCGTGGCTATGAGGGAAAAGGG + Intergenic
1016892572 6:149021191-149021213 GGCTGGTCCTTGAGGGAAACAGG + Intronic
1018614730 6:165676422-165676444 AACCTGGCCATGTGGGAAACCGG + Intronic
1019424047 7:964804-964826 CCCTTGGGCATGAGGTAAACCGG - Intronic
1019676871 7:2318891-2318913 GCCTTGGCCTTCAGGGTAGCTGG - Intronic
1019687121 7:2388176-2388198 ACCTGGGCCCTGAGGGAGGCTGG + Intergenic
1019827499 7:3296674-3296696 ACCTTAGCCTCGAGGGTACCTGG + Intergenic
1022859519 7:34352801-34352823 ATATTGTCATTGAGGGAAACTGG + Intergenic
1025189275 7:56884272-56884294 ACCTTGTCCATGAGGCTAACAGG - Intergenic
1025682665 7:63692645-63692667 ACCTTGTCCATGAGGCTAACAGG + Intergenic
1026079584 7:67205692-67205714 ACCTAGGCCATGAGAAAAACGGG - Intronic
1026628772 7:72019526-72019548 TCACTGGCTTTGAGGGAAACTGG + Intronic
1026697262 7:72606290-72606312 ACCTAGGCCATGAGAAAAACGGG + Intronic
1028271753 7:88799893-88799915 AGCGTGGCCTTCAGAGAAACAGG + Intronic
1028849343 7:95518879-95518901 ACCTGTGCCTTCAGGGAAAATGG + Intronic
1030094664 7:105887597-105887619 ACCCTGGCATTCAGGGAATCTGG + Intronic
1030834276 7:114263966-114263988 AGCTTGGCCTTCAGGAACACTGG + Intronic
1031755685 7:125638902-125638924 ATCTTGGCCTTGAGGGTAAGAGG - Intergenic
1033062612 7:138122801-138122823 ACCTTGGCCTTGACGGAAACGGG + Intergenic
1034471166 7:151255087-151255109 CCCTCGGCCTTGAGGGCACCAGG + Intronic
1034534099 7:151716237-151716259 CCCTTGGCCTTTAAGAAAACCGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1034830845 7:154306075-154306097 AGTTTGCTCTTGAGGGAAACAGG - Intronic
1035020589 7:155797844-155797866 AGCTTGGCCCTGGGGGAACCAGG + Intergenic
1035370051 7:158373983-158374005 GGCTGGGCCCTGAGGGAAACGGG + Intronic
1037637228 8:20710971-20710993 CCCTTGGCCTTTTGGGAAATTGG - Intergenic
1037782067 8:21876497-21876519 TCCTGGTGCTTGAGGGAAACAGG - Intergenic
1038756232 8:30343301-30343323 ACGTTCCCCTTGGGGGAAACTGG - Intergenic
1042595609 8:70444600-70444622 ACATTGTCATTGAGGGAAACTGG + Intergenic
1045161566 8:99552753-99552775 ACGTTTCCATTGAGGGAAACTGG - Intronic
1046067019 8:109209615-109209637 ACATTGTGCTAGAGGGAAACTGG + Intergenic
1046689963 8:117271881-117271903 ATTTTGGCATTTAGGGAAACTGG - Intergenic
1047198057 8:122739686-122739708 ACCTTGTCCTTGAGGAAAGCAGG + Intergenic
1049530410 8:143151697-143151719 CCCTTCCCCTTGAGGGAGACAGG - Intergenic
1050267380 9:3905416-3905438 ACCATGCCCTTTAGGGAAAGCGG + Intronic
1050467092 9:5938325-5938347 ACCTCAGCCTTGAGAGAAGCTGG - Intronic
1051870760 9:21735201-21735223 TCCTTGGCCTTGAAGGAAGTAGG + Intergenic
1052157172 9:25206581-25206603 AGCTTGCCCTTTAGTGAAACAGG - Intergenic
1189193429 X:39131817-39131839 GCCTTGATCTAGAGGGAAACCGG + Intergenic
1190583050 X:51907236-51907258 ACCTTTGCCTTCAGTGAAATTGG + Intergenic
1190958412 X:55220542-55220564 TCCGTGGCTTTGAGGGAAAAGGG + Exonic
1192917206 X:75665765-75665787 TGCTGGGCCTTGGGGGAAACTGG + Intergenic
1195356192 X:104041939-104041961 CCCTTGGTCAAGAGGGAAACAGG + Exonic
1195938471 X:110147015-110147037 ACCTTGCCTTTCAGGAAAACAGG - Intronic
1197291672 X:124666180-124666202 AGCCTGGCCTTGGGGGAAAGTGG - Intronic
1199396261 X:147342159-147342181 ACCTTGAACTTGAAGGAAAAGGG - Intergenic
1199505278 X:148554446-148554468 ACCTGTGCCTGGAGGGAGACAGG + Intronic
1199992178 X:152993458-152993480 CCCTTGCCCTTGAGGGAAAGTGG - Intronic