ID: 978455825

View in Genome Browser
Species Human (GRCh38)
Location 4:108890308-108890330
Sequence CAATGAAATAAGTGTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 224}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978455825_978455833 27 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455833 4:108890358-108890380 TGATGGATGACTTGTGGGTGAGG No data
978455825_978455827 -7 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455827 4:108890324-108890346 TTCATTGTAACTCAGGCACCAGG 0: 1
1: 0
2: 1
3: 14
4: 112
978455825_978455828 3 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455828 4:108890334-108890356 CTCAGGCACCAGGAAGTTACAGG 0: 1
1: 0
2: 1
3: 11
4: 169
978455825_978455832 22 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455832 4:108890353-108890375 CAGGATGATGGATGACTTGTGGG 0: 1
1: 0
2: 2
3: 8
4: 145
978455825_978455836 30 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455836 4:108890361-108890383 TGGATGACTTGTGGGTGAGGGGG 0: 1
1: 0
2: 0
3: 19
4: 233
978455825_978455829 10 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455829 4:108890341-108890363 ACCAGGAAGTTACAGGATGATGG 0: 1
1: 0
2: 3
3: 18
4: 183
978455825_978455835 29 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455835 4:108890360-108890382 ATGGATGACTTGTGGGTGAGGGG 0: 1
1: 0
2: 3
3: 26
4: 308
978455825_978455834 28 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455834 4:108890359-108890381 GATGGATGACTTGTGGGTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 205
978455825_978455831 21 Left 978455825 4:108890308-108890330 CCAGCTTTACACTTATTTCATTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 978455831 4:108890352-108890374 ACAGGATGATGGATGACTTGTGG 0: 1
1: 0
2: 0
3: 29
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978455825 Original CRISPR CAATGAAATAAGTGTAAAGC TGG (reversed) Intronic
901115848 1:6843138-6843160 AAAGGAAAAAAGTGTAAAGAAGG - Intronic
901450680 1:9335029-9335051 CACTCAAATAAATGCAAAGCAGG - Intronic
902117730 1:14135962-14135984 CCATGAACCAAGTGTAAAGTGGG - Intergenic
902781945 1:18710732-18710754 CAATAAAATATGTGTGAAGGAGG - Intronic
909145008 1:71918892-71918914 CAATGAAATATCTGTTAAGCCGG + Intronic
909319558 1:74266228-74266250 GACTGGAATAAGTGTAAGGCTGG + Intronic
909594700 1:77393460-77393482 TTATGAAATAAATGTAAAACGGG + Intronic
909969791 1:81968022-81968044 CATTGAAATAATTGTCAGGCTGG - Exonic
910582405 1:88843264-88843286 CAAAGAAATAAGAGTGGAGCAGG - Intergenic
910681067 1:89865046-89865068 CAATGTAATAAGTGAAATGTTGG - Intronic
911740652 1:101383647-101383669 CAATTTAATAAGGGTAAAGGAGG + Intergenic
912123328 1:106501657-106501679 AAGTAAAATAAGTGAAAAGCGGG - Intergenic
912739805 1:112183574-112183596 GAATAAAATAAGAGTTAAGCGGG - Intergenic
915091246 1:153428035-153428057 CAATGAAATAAGTAAACAGCAGG + Intergenic
915693373 1:157713634-157713656 CAAGGAAGAAAGTGCAAAGCAGG - Intergenic
918510263 1:185305064-185305086 CAATGTAATAAGTCTAAAAGTGG - Intronic
919735135 1:200944438-200944460 CAAAGAAAGAAGTGGAAAGACGG - Intergenic
921274391 1:213504739-213504761 CAAAGAAATAAGAATAAAACTGG - Intergenic
1062983066 10:1741895-1741917 GAATGAACTTGGTGTAAAGCAGG + Intergenic
1065070008 10:22013879-22013901 CAGTGAAAGAAGTGTATGGCTGG - Intergenic
1065073839 10:22056610-22056632 CCATGAAATAAGTGAAATTCTGG + Intergenic
1067156506 10:43785495-43785517 CATGGAAATAAGTGTCAAGTTGG - Intergenic
1067487935 10:46669364-46669386 CAATGGAAGAAGAGTAGAGCAGG - Intergenic
1067606872 10:47672644-47672666 CAATGGAAGAAGAGTAGAGCAGG + Intergenic
1068001796 10:51343749-51343771 CAATAAATAAATTGTAAAGCAGG + Intronic
1069275925 10:66590596-66590618 CACTGAATCAAATGTAAAGCTGG - Intronic
1069277278 10:66608497-66608519 CTATGTAAAAAGAGTAAAGCTGG + Intronic
1071169340 10:82845399-82845421 TAATGACATAAGTGTAAAAAAGG - Intronic
1071622432 10:87134004-87134026 CAATGGAAGAAGAGTAGAGCAGG + Intronic
1073876963 10:107935997-107936019 CAAGAAAATTTGTGTAAAGCAGG + Intergenic
1074493852 10:113961580-113961602 TAATTAAATAAGTCTGAAGCCGG + Intergenic
1074954548 10:118375658-118375680 CAAAGAAATAAGGTTAAAGATGG + Intergenic
1076047987 10:127310173-127310195 CTATGTAAAAAGTGTAAAGCAGG - Intronic
1078196328 11:9139938-9139960 CCATGAACTAAGTCTGAAGCTGG + Intronic
1078386314 11:10896027-10896049 TATTGAAATATGTGCAAAGCTGG + Intergenic
1078701327 11:13686653-13686675 TAATCAGAAAAGTGTAAAGCTGG - Intronic
1078889104 11:15537964-15537986 CAATGAGATCAGTGGAAATCAGG - Intergenic
1079145165 11:17844736-17844758 CAATGAAAGGAATCTAAAGCTGG - Intronic
1079547448 11:21650578-21650600 AAATGAAAAAAATGTAAAGCTGG - Intergenic
1079594159 11:22221336-22221358 GAATGAGATAACTGTAAAGTAGG + Intronic
1079966740 11:26989324-26989346 CAAGGAAATAAGTATAATGTGGG - Intergenic
1080172851 11:29327141-29327163 AAATGAGATAAGTGTTATGCAGG + Intergenic
1080420177 11:32103026-32103048 CACTGAACTAAGTCAAAAGCCGG + Intronic
1081180660 11:39982775-39982797 CTTTGATATAAGTGTAATGCTGG + Intergenic
1081478836 11:43464519-43464541 CAATGAACAAAATGAAAAGCTGG + Intronic
1082263621 11:50096887-50096909 CAATGACATAAGTATAGAGTGGG + Intergenic
1082769441 11:57195436-57195458 CCATGAGATAGGTGTAAAGCTGG - Intergenic
1085166050 11:74400231-74400253 CAATGAAAAAAGCATCAAGCAGG + Intergenic
1085862819 11:80254733-80254755 GAAAGAAAAAAGAGTAAAGCTGG - Intergenic
1086023954 11:82267544-82267566 CAATAAAATAACTGTAACGTAGG + Intergenic
1088094171 11:106078160-106078182 CCATGAAATAAGTGTAGGGAAGG + Intronic
1088977013 11:114824982-114825004 CAATGAAAGTAGAGCAAAGCAGG + Intergenic
1089991131 11:122861046-122861068 CAATGAAAAGAGGGAAAAGCTGG - Intronic
1093996799 12:25651616-25651638 CAATTAAAAATGTGTAAGGCTGG - Intergenic
1094131891 12:27083291-27083313 CAATGAAATAAGTTTTAAAAGGG - Intergenic
1097643317 12:62207132-62207154 CAATGGGATAAGTGTTAAGATGG - Intronic
1097966955 12:65591419-65591441 AAATAAAATAAATGTAAAACAGG + Intergenic
1098265986 12:68719729-68719751 CATTGAAAGTAGTGTAAAACTGG + Intronic
1098945925 12:76589551-76589573 AAATTTAATAAGTGTAAACCTGG - Intergenic
1099060838 12:77906164-77906186 CAATGAGAGAAGAATAAAGCAGG + Intronic
1099681880 12:85839841-85839863 AAATTAAATAAATGTAAAGTTGG - Intergenic
1100296315 12:93265327-93265349 CAATGAAAAAAGAGTAAGTCTGG - Intergenic
1104541145 12:129666041-129666063 CAATGAAATAAATGCACAGTCGG + Intronic
1108821195 13:54352384-54352406 CAATGAAACAAAAGTACAGCAGG - Intergenic
1109934379 13:69262678-69262700 CAATGAAAGCAGTGTTAAGAGGG - Intergenic
1111790313 13:92847027-92847049 CAATGGAATAAGAGTAAATGGGG - Intronic
1111865247 13:93760081-93760103 CAATGTAATAAGTGTCATACAGG + Intronic
1112832510 13:103471128-103471150 CAGTGCAATAAGAATAAAGCAGG - Intergenic
1112991770 13:105522538-105522560 CAAGGAAATAAGTGCAATGAAGG - Intergenic
1115182664 14:30647558-30647580 CAATGAAAGCAGTTCAAAGCAGG - Intronic
1115931433 14:38500737-38500759 CTTTGGAATAAGTGTAATGCCGG + Intergenic
1116283528 14:42942169-42942191 CAATGAAATAAGTGGAAAAATGG + Intergenic
1122375793 14:101256228-101256250 GAATGAAAAAAGTGAGAAGCAGG - Intergenic
1124432691 15:29620706-29620728 CAAAGAAATAAGTGGGAAGAAGG + Intergenic
1127289972 15:57561509-57561531 TAATGTAATGACTGTAAAGCTGG + Intergenic
1129083131 15:73059385-73059407 CTATGAAATAATTTTAAAGAAGG - Intronic
1130097022 15:80863491-80863513 GAATGAGATAAGTTTAAAGAAGG + Intronic
1130803402 15:87291776-87291798 CCATGGATTAAGTGTTAAGCTGG + Intergenic
1132255900 15:100375189-100375211 CAAAGAAATAATTGATAAGCTGG - Intergenic
1132768156 16:1545429-1545451 CAATGAAACAAGTCTAAACAGGG - Intronic
1133733508 16:8596266-8596288 TAATGACATAAGTGTGAAGATGG - Intergenic
1133903630 16:10000634-10000656 CAATGAAATCAGTGTAGATCCGG - Intronic
1134749779 16:16616841-16616863 CAAGGAAATAATTTTAAATCTGG + Intergenic
1134995694 16:18736774-18736796 CAAGGAAATAATTTTAAATCTGG - Intergenic
1136112563 16:28073866-28073888 CAATAAAAGAAGTGTCAGGCAGG - Intergenic
1136250619 16:29002228-29002250 CAATGAAATGAGTGTGAGGCTGG - Intergenic
1138174907 16:54888339-54888361 TAATAAAATAAGTGAAAAGCTGG + Intergenic
1138525406 16:57603076-57603098 CAATTAAAAATGTGTAAAGCAGG + Intergenic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1140957870 16:79883791-79883813 GAATGAAATAATTTTAAAGTAGG + Intergenic
1143471953 17:7180946-7180968 CACTGAAATAACTGTAAAATAGG - Intergenic
1145948132 17:28793573-28793595 CAATGAAAGAAGAGGAAAGGGGG - Intronic
1146438761 17:32876304-32876326 AAAAGAAGCAAGTGTAAAGCCGG + Intronic
1149189143 17:54037466-54037488 TAATTAAATAAGTATAAAGAAGG - Intergenic
1149336975 17:55645297-55645319 CAATAAAATCATTGTAAAACCGG - Intergenic
1150622335 17:66817434-66817456 TAATGAAATAAGAGTACATCAGG + Intergenic
1151121541 17:71798459-71798481 TAATGAAATAAGTAGAAAGAAGG + Intergenic
1151595090 17:75073570-75073592 CAATGAAAAAAGTGTCAGCCGGG - Intergenic
1156062028 18:33090346-33090368 TAATGAAATTAGTCTAAAACAGG + Intronic
1158190671 18:54824882-54824904 CAGAGCAATAAGTGTGAAGCAGG - Intronic
1159936489 18:74372241-74372263 CAGAGATATCAGTGTAAAGCTGG + Intergenic
1160579276 18:79874549-79874571 CAAAGAGAAAAGTGCAAAGCGGG + Intronic
1164199706 19:23006924-23006946 CAATGATATAATTGTATAGCTGG - Intergenic
1164798965 19:31060137-31060159 CAATGAAGTGAGTGTTAAACAGG - Intergenic
1167033782 19:46980820-46980842 TAATGATCTAAGTGGAAAGCTGG - Intronic
927628734 2:24751745-24751767 CAATGAAATAAATGTAAGCTCGG - Intronic
928168200 2:28986207-28986229 CAATGAGATAAGTGACAAGCAGG - Intronic
928801329 2:35096996-35097018 AAATTAAATAATTATAAAGCAGG - Intergenic
929497989 2:42463451-42463473 CATTCACATAAGTGTGAAGCTGG + Intronic
929881377 2:45840113-45840135 CAATGCTATCTGTGTAAAGCAGG - Intronic
933869650 2:86553305-86553327 CAATGCTATAAGTAGAAAGCAGG + Intronic
933897486 2:86824789-86824811 CAATGAAGTAAAGGAAAAGCAGG - Intronic
935407413 2:102723624-102723646 CAAAGAAATAAGAGAAAAGTAGG + Intronic
935730856 2:106064233-106064255 CAAAGAAAAAAGTGCAAAGTGGG - Intronic
938982182 2:136537392-136537414 CAATGGAATAGATGGAAAGCTGG - Intergenic
941730392 2:168911061-168911083 TAATGAAATATGTCTAAAGAAGG - Intronic
943603285 2:189946313-189946335 CAAAGATAGAAGTTTAAAGCTGG + Intronic
943974488 2:194455521-194455543 TACTGAAATAAATGTCAAGCTGG - Intergenic
944726251 2:202474157-202474179 CAAAGAAATAAGTGGATCGCCGG + Intronic
946764619 2:223028897-223028919 CATTTAAATAAGTGGAAAGATGG - Intergenic
947281230 2:228457717-228457739 CAATTAAATCAGTGTTAAGAGGG - Intergenic
948413823 2:237785971-237785993 CTATGAAAAAAGTTGAAAGCAGG + Intronic
1170285052 20:14697807-14697829 CAATGACAGCAGTTTAAAGCTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174379034 20:50144835-50144857 AAAGGAAATAAGGGAAAAGCCGG - Intronic
1174822051 20:53734854-53734876 CAATGAAATAATTTAAAATCTGG - Intergenic
1175198312 20:57261468-57261490 AAATGAAAAAAGTTCAAAGCTGG + Intronic
1175446798 20:59026479-59026501 CAATGAAATAGATGTAAGGAAGG + Exonic
1177455962 21:21339571-21339593 TAATGAAAAAAGTTTAAAGGAGG - Intronic
1178335311 21:31737261-31737283 GAATGAAATGTGTGGAAAGCAGG + Intergenic
1180197094 21:46203540-46203562 CACTGTAATAAAAGTAAAGCAGG - Intronic
1180798300 22:18618691-18618713 CTATGAAATAAAAGTGAAGCTGG + Intergenic
1181223418 22:21376574-21376596 CTATGAAATAAAAGTGAAGCTGG - Intergenic
1181255322 22:21559048-21559070 CTATGAAATAAAAGTGAAGCTGG + Intronic
1182291625 22:29284367-29284389 CAATGAAATGAGTGCAAAAAAGG - Intronic
1182842189 22:33400330-33400352 CAATGCAATAATTGAAGAGCTGG + Intronic
950806470 3:15607826-15607848 CAATGCAAAAACTGTACAGCCGG + Intronic
951219458 3:20054092-20054114 AAAAAAAATAAGTCTAAAGCCGG - Intronic
951510796 3:23499918-23499940 CAATGAAATCAGTAAAAAGCTGG - Intronic
951902746 3:27673095-27673117 CTATGAAATAAATTTACAGCAGG - Intergenic
951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG + Intergenic
952915472 3:38235791-38235813 CAATGAATGAAGTGTGAAGATGG + Intronic
953594192 3:44292640-44292662 CAATAAAAAAAGTGAAAAGCTGG - Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
955678672 3:61477063-61477085 GAATGAAACAAGTAAAAAGCTGG + Intergenic
957450093 3:80369090-80369112 TAAAGAAAGAAGTGTAAAGGAGG + Intergenic
959180419 3:102972045-102972067 TACTGAAAAAAGTCTAAAGCTGG + Intergenic
959406208 3:105964612-105964634 CAAAGAAAGCAGTGTGAAGCTGG - Intergenic
962569969 3:136703151-136703173 CACTGAAACAATTATAAAGCTGG + Intronic
964501230 3:157350378-157350400 CAAAGACCTAAGTGTAAAACTGG + Intronic
965372876 3:167886428-167886450 CAATAAAAGAAGTCTAAAGTAGG + Intergenic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
966666293 3:182475034-182475056 AGATGAAATAAATGTAAAACAGG + Intergenic
966958961 3:184914200-184914222 CAATGTAACAAGTGTGAAACAGG - Intronic
970633436 4:17980197-17980219 CCATGAAATTAGTTTGAAGCAGG - Intronic
971790537 4:31164870-31164892 AAATGAAATAAATTTAAAGTAGG + Intergenic
972717566 4:41662942-41662964 AAATGAAATGAGTGGAAAGGTGG + Exonic
973861739 4:55071931-55071953 AAATGAGATGTGTGTAAAGCAGG - Intergenic
975788929 4:77926455-77926477 GAAGGAAAAAATTGTAAAGCTGG - Intronic
976110104 4:81663678-81663700 AAATGAATTATGTGTAAAACAGG + Intronic
976659313 4:87522793-87522815 CACTGAAATAAGTGTTATGAAGG - Intronic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
979165867 4:117530061-117530083 CAAAGGAATAAGGGTAGAGCTGG - Intergenic
979456844 4:120935546-120935568 CCATGAAAAAAATGTAAAACTGG - Intergenic
979992681 4:127393593-127393615 GAATCAGATACGTGTAAAGCAGG + Intergenic
980436782 4:132786245-132786267 TAATGAAATAACAGTACAGCAGG - Intergenic
980787907 4:137578448-137578470 TTATTAAATCAGTGTAAAGCAGG + Intergenic
983395273 4:167186288-167186310 AAATGAGAAAAATGTAAAGCTGG - Intronic
984053605 4:174897833-174897855 CAATGAAAGCAGAGTAGAGCAGG + Intronic
985007829 4:185551794-185551816 CAATCAAATAAGTGAGAAGCTGG - Intergenic
987186508 5:15425905-15425927 CAATGCAAAAATTGTAGAGCTGG - Intergenic
988176680 5:27735617-27735639 CAATGAAATAAGTTCAAATATGG + Intergenic
988529597 5:32016072-32016094 CAAGGAAAGAAGAGCAAAGCAGG + Intronic
989752100 5:44907411-44907433 CAATGAAATATGTATAAACGTGG - Intergenic
989771312 5:45149740-45149762 TAAAGAAATAAGTGCAAGGCAGG - Intergenic
990025926 5:51188653-51188675 CAAGGAAATCAGTGGAAAGAGGG - Intergenic
990072074 5:51795044-51795066 GAATCAAATAAGTTAAAAGCAGG - Intergenic
991636769 5:68714195-68714217 CAATGAAATAAGTGTTTTGTAGG - Intergenic
991996568 5:72393195-72393217 CAATGAAAAAGTTGTAAAACTGG - Intergenic
992024117 5:72653997-72654019 CTATGAACTAAGTGGAAAACAGG - Intergenic
992226613 5:74625155-74625177 AAATGAGATGACTGTAAAGCAGG + Intergenic
992601023 5:78399799-78399821 GAAAGAAATAATTGAAAAGCTGG - Intronic
992776748 5:80095732-80095754 CTATGAAAGAAGGGTAGAGCTGG - Intergenic
994634876 5:102332353-102332375 CAATAACATCAGTGAAAAGCTGG - Intergenic
994713758 5:103297424-103297446 CAATGAAATAAGTTCAAATATGG + Intergenic
1000904529 5:166948373-166948395 CAATGAAATGAATATAAAGGAGG + Intergenic
1003780259 6:9416443-9416465 CAATGGACTTAGTGTAAAGCAGG + Intergenic
1003986991 6:11445743-11445765 CAAAAAAAAAAGTGTAAAGAGGG - Intergenic
1009468767 6:64005910-64005932 CAAAGCAAAAAGTGCAAAGCTGG - Intronic
1009884549 6:69610282-69610304 CAATTAAATAAATGGATAGCAGG + Intergenic
1010417062 6:75624489-75624511 CGATGGAACAAGTGTAAATCTGG - Intronic
1011059720 6:83251033-83251055 CAATGTAATATGTCTAAAGCAGG - Intronic
1012966195 6:105676101-105676123 CAATTATCTAAGTGTAGAGCAGG - Intergenic
1013126903 6:107192818-107192840 CAAGGAAAGAAGAGTAAAGGTGG + Intronic
1013689508 6:112624156-112624178 GAAGGAAAAAAGTGTATAGCAGG - Intergenic
1013924843 6:115459342-115459364 AAATGAAATAATAGTAAAGAAGG + Intergenic
1014708330 6:124775803-124775825 CAATTAAATCAGTGTCAAGAGGG - Intronic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1016863617 6:148746303-148746325 CAATGAAATCAGCGTATAGGCGG + Intergenic
1016929179 6:149385938-149385960 CAGTTAAATAAGGGAAAAGCTGG - Intronic
1017138322 6:151167668-151167690 CAATGAGATAGGAGTAAAGCCGG + Intergenic
1017227316 6:152037083-152037105 TTAAGAAATAAATGTAAAGCAGG - Intronic
1018230605 6:161671495-161671517 CAATAAATTAAGTGTGATGCTGG + Intronic
1018700026 6:166419106-166419128 TGATGAAATAAGTGAAAAGCAGG + Intronic
1018858433 6:167692366-167692388 CAAAGAAACAAGTGGAAAGAGGG + Intergenic
1018858662 6:167694291-167694313 CAAGGAAAAAAATGTAAATCTGG - Intergenic
1020541853 7:9468617-9468639 CAATGAAAAAAGAGAAATGCAGG + Intergenic
1020836929 7:13165259-13165281 CCATGAAATCAGTGAAAGGCAGG + Intergenic
1020957915 7:14765689-14765711 CAATAAAATACGTATAAAGGTGG - Intronic
1021508050 7:21406905-21406927 CAATGTGATAAATGTAAAGAAGG + Intergenic
1022166532 7:27769909-27769931 CAATTAAGTAAGTGAAAACCAGG + Intronic
1023583220 7:41703909-41703931 CCTTGAAATAGGGGTAAAGCTGG + Intergenic
1023595512 7:41825666-41825688 CAATTAAATAAATATGAAGCTGG + Intergenic
1023679434 7:42669638-42669660 CAATGAACAAAGCCTAAAGCTGG + Intergenic
1027871145 7:83709998-83710020 TAATGAAATAACTGAAGAGCAGG - Intergenic
1027997075 7:85437879-85437901 CAATCAAACAACTGAAAAGCAGG - Intergenic
1028069265 7:86430883-86430905 CATACAAATCAGTGTAAAGCTGG + Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1029524128 7:101084955-101084977 CAATGAGATGAGTTTAAAGAAGG - Intergenic
1030659180 7:112201958-112201980 AAATGAAGTAAGTGTAAGTCTGG - Intronic
1033191034 7:139279831-139279853 GGATGAAATCTGTGTAAAGCTGG + Intronic
1037110824 8:15162566-15162588 CCATAAGATAAGTGAAAAGCTGG - Intronic
1037793922 8:21975402-21975424 CTAAGAAAGAAGTGTTAAGCTGG + Intronic
1041109800 8:54473578-54473600 CTATGAAGTAAGTGTAGACCAGG - Intergenic
1041959884 8:63601043-63601065 CAATGAACTAGGGGTAAAGAAGG - Intergenic
1042491531 8:69404344-69404366 CATTGAAATAATTGGAAACCAGG - Intergenic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1045255280 8:100514948-100514970 CAATGAAATATGTGTAAAGATGG - Intronic
1045568541 8:103346149-103346171 CAATGAAATGTGTATAGAGCAGG + Intergenic
1045623889 8:104018575-104018597 AAATGAACTGAATGTAAAGCTGG - Intronic
1047455428 8:125005169-125005191 CATTGAAAGAAGTGTTAAGAAGG + Intronic
1048112619 8:131485219-131485241 GAATAAAATAAGTGGAGAGCTGG - Intergenic
1050110106 9:2206469-2206491 CAATGATATAAAGGTAAACCGGG - Intergenic
1050247180 9:3703137-3703159 CAATGGAATAAGTAGAAAGGTGG + Intergenic
1051162016 9:14219589-14219611 CCATAAAATACGTGTAAAGCAGG - Intronic
1055133064 9:72797418-72797440 CAAAGAAAAAAGAATAAAGCTGG + Intronic
1055541348 9:77308881-77308903 CAATGCTGTAAATGTAAAGCTGG - Intronic
1056120714 9:83485170-83485192 CAATGAAATGAGCGTAACTCAGG - Intronic
1059062002 9:111042793-111042815 CAATGAAAAAAGAGAAAAGAAGG + Intergenic
1060879311 9:127106843-127106865 GTGTGAAATAAGTGTAAAGCAGG + Intronic
1187360009 X:18617230-18617252 CAATGAGACAAGTGGTAAGCAGG - Intronic
1188153580 X:26712082-26712104 CAATGGGATAAGTGTAAACTAGG + Intergenic
1188953038 X:36400193-36400215 GAATTAAATAAATGTAAAGATGG - Intergenic
1191689184 X:63922253-63922275 CAGTGGAACAAATGTAAAGCAGG + Intergenic
1195669116 X:107454247-107454269 CAATAAAGAAAGTGGAAAGCAGG - Intergenic
1195751087 X:108162563-108162585 CAATGAAAAAAGTCCAAGGCTGG - Intronic
1196270608 X:113706189-113706211 AAATGAAATAATTGATAAGCTGG - Intergenic
1199587878 X:149435719-149435741 CAATGAAAAAACTATAAAGATGG + Intergenic
1200550795 Y:4577107-4577129 CAATGAAATTAGTTCAAAACAGG + Intergenic