ID: 978456040

View in Genome Browser
Species Human (GRCh38)
Location 4:108892986-108893008
Sequence TATCCCACCCTAATTGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978456040_978456045 16 Left 978456040 4:108892986-108893008 CCGGCACCAATTAGGGTGGGATA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG 0: 1
1: 0
2: 5
3: 67
4: 714
978456040_978456046 20 Left 978456040 4:108892986-108893008 CCGGCACCAATTAGGGTGGGATA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 978456046 4:108893029-108893051 TGAAAAGAAGACAGTTTGGTTGG 0: 1
1: 0
2: 2
3: 42
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978456040 Original CRISPR TATCCCACCCTAATTGGTGC CGG (reversed) Intronic
906808417 1:48802319-48802341 TATCCCAACCTAATTTTTCCTGG - Intronic
923263325 1:232288343-232288365 TTTCCCACCCTCGTTGGAGCTGG - Intergenic
1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG + Intronic
1063725757 10:8635675-8635697 TATCCCACCCCAATAGGAGGCGG - Intergenic
1066463034 10:35628942-35628964 TATAGCACCCCAAATGGTGCAGG - Intergenic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1076934716 10:133559681-133559703 AACCCCACCCAAATTGCTGCAGG - Intronic
1083014839 11:59442865-59442887 TATCTCACCCAAAATGGTGGAGG + Intergenic
1084312320 11:68324294-68324316 TATCCCACCCCACTAGGTCCCGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088302050 11:108368731-108368753 TTTCCCACCCTACTTTGTGCAGG + Exonic
1091634381 12:2186157-2186179 CATCCCACGCTAATTGGTCCTGG - Intronic
1092217296 12:6692482-6692504 TATCCCACCCTCCTTGGATCTGG + Intergenic
1094538809 12:31345742-31345764 TATGCCATCTTAATTGGTGAAGG - Intergenic
1096797469 12:54086861-54086883 TATCCCTCCCTCTCTGGTGCTGG - Intergenic
1103381543 12:120497335-120497357 TCTCCCACCCTAAGAGGTACTGG - Intronic
1113634343 13:111909639-111909661 TATCCCGCCGTGAGTGGTGCTGG + Intergenic
1120304057 14:82745723-82745745 TATCCCATGCTACTTGGTGAAGG - Intergenic
1120467039 14:84872147-84872169 TTTCCCATCCTAATTGGGGATGG + Intergenic
1121148816 14:91611264-91611286 TATTCCAATCTAATTGGTTCGGG + Intronic
1123930170 15:25164922-25164944 TATCCCAGCCCAAATGGTGAGGG + Intergenic
1133038350 16:3046790-3046812 GATCCCTCCCTACTCGGTGCCGG + Exonic
1144018594 17:11220552-11220574 TATTCCACCTTAATTTGTGGTGG - Intergenic
1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG + Intergenic
1144991386 17:19236554-19236576 ACTCCCACCCTGATTGGAGCAGG + Intronic
1148549076 17:48539497-48539519 TATTCCATCCTGATTGGGGCAGG - Intergenic
1151653961 17:75486805-75486827 TACCCCACCCCAATTCCTGCAGG - Intronic
1155480448 18:26281016-26281038 TATCCTAAGCAAATTGGTGCAGG + Intronic
930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG + Intergenic
931873924 2:66491467-66491489 TATTCCACCTTAATGGGTGGGGG + Intronic
933104828 2:78311258-78311280 ATGCCCACCCTAATTGGTGAGGG - Intergenic
936650757 2:114423408-114423430 AATCCCTCTCTAATTGCTGCAGG - Intergenic
937558525 2:123191023-123191045 TATCCAACCTTAATTGATTCTGG - Intergenic
937683789 2:124672706-124672728 TATTCCATCCTGATTGGTACAGG - Intronic
948592186 2:239058109-239058131 TCTGGCACCCTAATTGGGGCTGG + Intronic
1171396976 20:24841335-24841357 TATCCCAAGCGAATTAGTGCAGG + Intergenic
1171849308 20:30296719-30296741 TATCCCTCCCTCTCTGGTGCTGG - Intergenic
1173058892 20:39642987-39643009 TATCCCAACCAAATAGGTTCTGG + Intergenic
952285976 3:31970171-31970193 GATCTAACCCTAATTGATGCAGG - Intronic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
959582016 3:107992081-107992103 TATCACACACAAATTGGGGCTGG - Intergenic
961167980 3:124776774-124776796 TTTCCTACTCTAATTGTTGCTGG + Intronic
968955653 4:3717527-3717549 GACCCCACTCTAGTTGGTGCAGG - Intergenic
970797523 4:19931330-19931352 TATCCCAAGCAAATTGGTGCAGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973150899 4:46887219-46887241 TATCCCACCCTAAAGGGTATGGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG + Intergenic
982478150 4:155877768-155877790 TACCCCACCCTGATGGCTGCAGG - Intronic
987520645 5:18978869-18978891 TATTCCACCCTAAACGGTGAAGG - Intergenic
996314925 5:122150928-122150950 TATCCCACCAGGATGGGTGCCGG + Intronic
1002346618 5:178552269-178552291 TCTCCTACCCTATTTTGTGCTGG - Intronic
1014539681 6:122660167-122660189 AAACCCACCTTAATTGGTGGGGG - Intronic
1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG + Intergenic
1021442375 7:20690744-20690766 TATCCGAATCTAAATGGTGCAGG - Intronic
1032988725 7:137366881-137366903 TTTCCCAGCCTATTTGGTGTCGG + Intergenic
1034204339 7:149302576-149302598 AATACCACCCTACTTGCTGCTGG + Intergenic
1042604363 8:70530939-70530961 TTTCCCACACTAATTGGCGGAGG - Intergenic
1050816526 9:9819762-9819784 TATCCTAAGCAAATTGGTGCAGG - Intronic
1052642909 9:31192409-31192431 GATCTCACCCTAATGGGAGCAGG - Intergenic
1053787030 9:41659430-41659452 TATCCCTCCCTCTCTGGTGCTGG - Intergenic
1054158030 9:61654757-61654779 TATCCCTCCCTCTCTGGTGCTGG + Intergenic
1054477803 9:65585762-65585784 TATCCCTCCCTCTCTGGTGCTGG + Intergenic
1056968565 9:91184259-91184281 TCTTCCACCCTACTTGGTGTGGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1192194990 X:69022051-69022073 TTTCCCTCCCTAATTTGTGGGGG + Intergenic