ID: 978456045

View in Genome Browser
Species Human (GRCh38)
Location 4:108893025-108893047
Sequence TTTATGAAAAGAAGACAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 714}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978456042_978456045 10 Left 978456042 4:108892992-108893014 CCAATTAGGGTGGGATAGGCCTT 0: 1
1: 0
2: 0
3: 0
4: 65
Right 978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG 0: 1
1: 0
2: 5
3: 67
4: 714
978456040_978456045 16 Left 978456040 4:108892986-108893008 CCGGCACCAATTAGGGTGGGATA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG 0: 1
1: 0
2: 5
3: 67
4: 714
978456044_978456045 -9 Left 978456044 4:108893011-108893033 CCTTCAGGTGTGATTTTATGAAA 0: 1
1: 0
2: 2
3: 19
4: 236
Right 978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG 0: 1
1: 0
2: 5
3: 67
4: 714
978456039_978456045 17 Left 978456039 4:108892985-108893007 CCCGGCACCAATTAGGGTGGGAT 0: 1
1: 0
2: 1
3: 4
4: 69
Right 978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG 0: 1
1: 0
2: 5
3: 67
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978456045 Original CRISPR TTTATGAAAAGAAGACAGTT TGG Intronic
903199667 1:21724477-21724499 TTTATGAAATAAACACAGTAGGG - Intronic
903534223 1:24056143-24056165 TTTTTAAAAAGAAAAAAGTTGGG + Exonic
904000238 1:27334815-27334837 GTTCTGAAAAGAAGACTTTTAGG + Intronic
904797196 1:33065472-33065494 TTCATGAAAAGAAGATAAGTAGG - Intronic
906172393 1:43738194-43738216 GTTATCAAAAGAAGACAGAGAGG + Intronic
906605880 1:47171259-47171281 CTTCTCAAAAGAAGACATTTAGG + Intergenic
906855868 1:49303774-49303796 CTTCTCAAAAGAAGACATTTAGG - Intronic
906913368 1:49981291-49981313 TTTATGCAAAAAAGACAATATGG + Intronic
907528825 1:55072160-55072182 TCTATGAAAAGAAAACAGATTGG - Intronic
908285946 1:62601569-62601591 TTTTTTAAAAGAAAATAGTTTGG + Intronic
908952219 1:69575127-69575149 TTTATAAAAAGAAGAAACTGAGG + Intronic
909179258 1:72400301-72400323 TTTATTCAAAGGAGCCAGTTGGG + Intergenic
909730976 1:78888936-78888958 TGGATGAAAAGAAGACAGTTGGG + Intergenic
909811699 1:79939174-79939196 CTTCTCAAAAGAAGACATTTAGG - Intergenic
909889550 1:80986785-80986807 GTTATGAAAAGACCACATTTAGG - Intergenic
909939327 1:81592364-81592386 TTTACAAAAAGAAGTGAGTTGGG + Intronic
909973020 1:82013517-82013539 TTTCTGAAAAGAAGAAAGTAAGG + Intergenic
910074327 1:83259689-83259711 TTTATGTAAAGAAGGGAGTCAGG - Intergenic
910217994 1:84861770-84861792 TTAATGGAAGAAAGACAGTTTGG - Intronic
910704286 1:90110469-90110491 TATATGAAAAAAAGATACTTTGG + Intergenic
910848710 1:91629505-91629527 TTTCTGAAAAAAAGACAGCTAGG - Intergenic
911442527 1:97945379-97945401 TTTAAGAAAAAAAATCAGTTGGG + Intergenic
911572760 1:99537707-99537729 TTATTGAAAAGAAGAGAATTTGG - Intergenic
911608103 1:99931430-99931452 ATTAAGAAAATAAGACAGATGGG - Intergenic
912093863 1:106115348-106115370 CTTCTCAAAAGAAGACATTTAGG + Intergenic
913006164 1:114633872-114633894 TTTATGAACAGCATAGAGTTAGG - Intronic
913015023 1:114724193-114724215 TTTAGGAAAAGCAGGCATTTTGG - Intronic
913309063 1:117467446-117467468 TTTATGAAAGGAAAGCAGATAGG + Intronic
914801800 1:150967682-150967704 TCTATGACATGAAGAAAGTTTGG - Exonic
914966221 1:152260032-152260054 CTTCTCAAAAGAAGACATTTAGG - Intergenic
915370351 1:155344692-155344714 TTTAAAAAAAGAAGAGATTTAGG - Intronic
915775346 1:158478584-158478606 TTTATGAAAAAATGAAAATTGGG - Intergenic
916986520 1:170197812-170197834 TTTATGAAATGAGGACTGCTGGG + Intergenic
917150616 1:171940277-171940299 TTTATGAAACAAATACACTTTGG - Intronic
917549443 1:176008643-176008665 TTACTGAAAAGCAGACACTTTGG + Intronic
918634430 1:186758169-186758191 ATTAAGAAAAGAAAACTGTTAGG - Intergenic
918660728 1:187084928-187084950 TTTAAGAAAAAAATTCAGTTGGG - Intergenic
918703410 1:187633388-187633410 CTTCTCAAAAGAAGACATTTAGG + Intergenic
918748199 1:188233999-188234021 TGTATGTAGAGAAGAAAGTTAGG + Intergenic
918791666 1:188838170-188838192 CTTCTCAAAAGAAGACATTTAGG + Intergenic
918823409 1:189289196-189289218 TTTTTGTAAAGAAGTCAGCTTGG - Intergenic
919308193 1:195871413-195871435 TTCATGAAAAGGAGACATTTAGG - Intergenic
919782823 1:201232478-201232500 CTTCTCAAAAGAAGACATTTAGG + Intergenic
920105747 1:203552136-203552158 TTTATGAAAACAAGGCAGGCCGG + Intergenic
920280293 1:204838462-204838484 ATTATGAAAACAAGAAAGTCAGG - Intronic
920890617 1:209981755-209981777 TTCTTGAAAAGAAGAAAGTCTGG - Intronic
921734154 1:218607800-218607822 TTTATGACAATAAGACACTCAGG - Intergenic
921742124 1:218697108-218697130 TTATTCAAAAGAATACAGTTGGG - Intergenic
921846826 1:219892032-219892054 CTTCTCAAAAGAAGACATTTAGG + Intronic
921999350 1:221459390-221459412 TTTATGAAGAGAAGAGAAGTTGG + Intergenic
922964946 1:229681540-229681562 TTTCTGAAAAAAAAACAGTTAGG + Intergenic
924029410 1:239871101-239871123 TTCAAGAAAAGTAGACAGTTGGG + Intronic
924264328 1:242266556-242266578 TTTATGATAAGGAGACAGACGGG - Intronic
1062991062 10:1818412-1818434 TTTATGAAAAAAACAGAATTTGG + Intergenic
1063041152 10:2338496-2338518 TTTCTCAAAAGAAGAATGTTGGG - Intergenic
1063289313 10:4727255-4727277 TTTGTGTAAAGCAGACAGTAGGG + Intergenic
1063805308 10:9632441-9632463 TTTATTAAATGCAGACAGGTAGG + Intergenic
1063877120 10:10491869-10491891 TTTATGAAAAGACGATCATTTGG - Intergenic
1064504944 10:16018488-16018510 ATTCTCAAAAGAAGACATTTAGG - Intergenic
1064518164 10:16172361-16172383 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1064522432 10:16217056-16217078 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1064829698 10:19448883-19448905 TTTATGAAGTGAATTCAGTTAGG - Intronic
1064868916 10:19915429-19915451 TGTATGTAAAGAAGACATTTAGG - Intronic
1065285475 10:24183457-24183479 ATAATGAAAAAAAGACAGTGGGG + Intronic
1066154030 10:32655845-32655867 TTTCTCAAAAGAAGACATATAGG - Intronic
1066720476 10:38331913-38331935 TTTATGATAAGGAGACAGACGGG + Intergenic
1067999966 10:51321185-51321207 GTTATGTAAAGAGGTCAGTTTGG - Intronic
1068028192 10:51675053-51675075 TTTATGAAGAGAAGACTGAATGG + Intronic
1068147692 10:53092086-53092108 TTTATGAAATGAGGACAAGTAGG + Intergenic
1068343727 10:55742822-55742844 CTTATAAAGAAAAGACAGTTGGG - Intergenic
1068455421 10:57249000-57249022 TTTATAAAAAGAAAATATTTGGG + Intergenic
1068534542 10:58227027-58227049 TTTATGACAAGATTACCGTTTGG + Exonic
1068838881 10:61588079-61588101 TATGTGAAAAGAAAACATTTGGG + Intergenic
1069780024 10:70949570-70949592 ATTATGAGAGGAAGCCAGTTCGG + Intergenic
1070026012 10:72632944-72632966 TTTTTGTAAAGAAAAAAGTTAGG + Intergenic
1070260538 10:74850528-74850550 TTTATGCTAAGAAGCCAGTGTGG - Intronic
1070299729 10:75194435-75194457 TGTATGAACAGAGGACAGTGGGG - Intergenic
1070709723 10:78671740-78671762 CTTCTCAAAAGAAGACACTTAGG + Intergenic
1070838459 10:79466641-79466663 TTTTAAAAAAGAACACAGTTTGG + Intergenic
1072010253 10:91297012-91297034 TGTATGATAAAAAGACAGTGCGG + Intergenic
1072025684 10:91453765-91453787 CTTATAAATAGAAAACAGTTGGG - Intronic
1072563620 10:96599267-96599289 CTCATGAGAAGAAGGCAGTTTGG + Intronic
1072774067 10:98171650-98171672 ATTATGAGAAGAAGTCATTTGGG + Intronic
1072788336 10:98299883-98299905 ATTATGCAAAGCAGTCAGTTTGG - Intergenic
1072825818 10:98605187-98605209 TTTGTGAAAATAAGACAGGGAGG - Intronic
1073949450 10:108789631-108789653 TTGATAAAAAGAAGAGAATTCGG + Intergenic
1074354912 10:112774001-112774023 TTTGGCAAAAGAAGACAGCTAGG + Intronic
1074383843 10:113001610-113001632 TTTATGACACAAAGAAAGTTTGG + Intronic
1074540902 10:114364544-114364566 CTTATAAGAAGAAGAGAGTTTGG - Intronic
1074623457 10:115151508-115151530 CTTCTCAAAAGAAGACATTTAGG - Intronic
1074660286 10:115647586-115647608 CTTCTCAAAAGAAGACATTTAGG - Intronic
1075203037 10:120422279-120422301 TTTATAAAATGAAGCAAGTTTGG - Intergenic
1075585320 10:123653181-123653203 TATAGCAAAAGAAGACAGTTTGG - Intergenic
1075775278 10:124980053-124980075 TTTTTGTAAAAAAGACAGCTGGG + Intronic
1076360962 10:129888685-129888707 TTTATGAAAACAAGGCTATTAGG + Intronic
1077750244 11:4959410-4959432 TTTATTAAGAGAAGACAGAATGG - Intronic
1078412553 11:11138425-11138447 TTTATGAGAAGATGACATTTTGG + Intergenic
1078481486 11:11680012-11680034 TTTAAGAAAAAAAGAGAGCTGGG + Intergenic
1078560223 11:12364685-12364707 TTTATGGGAAGAAGAAAATTTGG - Intergenic
1078605667 11:12772965-12772987 TTTATAAACAGAGGACAGATCGG - Intronic
1078973002 11:16436878-16436900 TCCATGAAAAGATGATAGTTTGG - Intronic
1080057056 11:27917272-27917294 TTCATGAAAAGAAGAGGCTTGGG + Intergenic
1080306949 11:30846836-30846858 TTTGTGAAAAGAAGAAGGTGGGG - Intronic
1080351900 11:31394514-31394536 ATTATGAAAAAAAAACAGTGTGG - Intronic
1080945925 11:36975142-36975164 TTTTTGAAATGAGGAAAGTTTGG + Intergenic
1081826194 11:46055050-46055072 TTTATGAAAGAAAGACGTTTTGG - Intronic
1082048601 11:47751650-47751672 TTTTTTAAAAAAAAACAGTTTGG + Intronic
1082572396 11:54759523-54759545 TTCATGAAAAGAAGTAAGATAGG - Intergenic
1083182370 11:60995533-60995555 TTTCTAAAAAGAAAATAGTTAGG + Intronic
1083336010 11:61922223-61922245 TTTAAAAAAAGAAGACAGCTGGG + Intergenic
1083570917 11:63762075-63762097 TTTGTGAAGAGCAGACAGTAGGG + Exonic
1084348083 11:68571119-68571141 TTTTTGAAAGGAATTCAGTTTGG + Intronic
1085256168 11:75174608-75174630 TTCAGGGGAAGAAGACAGTTTGG + Intronic
1086643044 11:89183828-89183850 TTTTTGAAAACAAGACCATTGGG - Intronic
1087127336 11:94640869-94640891 TTTATTTAAAGGAGACAGGTGGG - Intergenic
1087663433 11:101014360-101014382 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1087888513 11:103508812-103508834 TTTTTCAAAAGAAGACATTAGGG + Intergenic
1088093632 11:106073751-106073773 TTAATGAAAGGAAGAGGGTTAGG + Intronic
1088104222 11:106187583-106187605 TTTATAAAGAGAAGAAATTTTGG + Intergenic
1088691707 11:112334120-112334142 TTTCTAAAAAGAAGACACTTTGG + Intergenic
1089059141 11:115612038-115612060 TTTCTGAAAATGAGACAGCTGGG - Intergenic
1089722017 11:120434159-120434181 TGTAAGAAAAGAAGACTGCTTGG + Intronic
1090103309 11:123824930-123824952 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1090720955 11:129472693-129472715 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1090991892 11:131825214-131825236 TTTATGAAAAGGGGAGATTTGGG - Intronic
1091195278 11:133725663-133725685 TTTAGAAGCAGAAGACAGTTGGG - Intergenic
1091865508 12:3832455-3832477 TGTGTGAAAAGGAGACAGTGGGG - Intronic
1094104343 12:26794061-26794083 CTTATGAAGAGAAGATAGGTAGG - Intronic
1094113434 12:26884802-26884824 TTTATGCAGAGAAGTCAGCTGGG + Intergenic
1094446724 12:30539023-30539045 TTAATTAAAAAAAGACACTTAGG + Intergenic
1094683621 12:32688253-32688275 TTTCTGTAAACAAGACAGTTGGG + Intronic
1095905272 12:47370737-47370759 TTTATGGAAAGCATTCAGTTTGG - Intergenic
1096762869 12:53857680-53857702 TTTCTGCAAAGAAGCCAGTTGGG - Intergenic
1096824635 12:54265670-54265692 TTTATTAAAAGAAGAGAGCATGG + Intronic
1098560602 12:71867408-71867430 TTTATGAAAAGAATAAATTGAGG - Intronic
1098618937 12:72567306-72567328 TTAATGAAAAAAAAACATTTTGG - Intronic
1098838358 12:75448491-75448513 TTTTTCAAAAGAATACAGTTTGG + Intergenic
1099306027 12:80957270-80957292 TTCTTGAAAAGAAGAAAGGTGGG - Intronic
1099392746 12:82100663-82100685 TTTATGAAGAGAAGTGAGTAAGG + Intergenic
1099468756 12:83020352-83020374 TTAATTAAAAGCAGACACTTTGG + Intronic
1100165132 12:91908388-91908410 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1100213240 12:92420119-92420141 TTTAAGAAAAGCAAACAGATGGG + Exonic
1100709229 12:97236723-97236745 TTTATGAAAAAAATACATTATGG + Intergenic
1101068744 12:101050685-101050707 TTTAGGAAATGAATACATTTAGG - Intronic
1101184129 12:102255409-102255431 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1101250257 12:102927079-102927101 ATTAGGAATAGAAGACACTTAGG + Intronic
1101372372 12:104141086-104141108 GTGATGAAAAGAAGCCAGTGAGG - Intergenic
1101542263 12:105675934-105675956 TTTCTGGAAAGAACAAAGTTTGG - Intergenic
1101600761 12:106207582-106207604 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1101712194 12:107278431-107278453 TTTAAGAAAATTAGTCAGTTGGG + Intergenic
1101808558 12:108087607-108087629 TTTTTTAAAAAAAGACATTTAGG + Intergenic
1102662931 12:114545428-114545450 TTTACGCATAGAAGACAGTCCGG + Intergenic
1102843984 12:116157997-116158019 TTTCTGAATAGAAGACAGTCCGG + Intronic
1102863646 12:116357304-116357326 TTTTTAAAAAGAAGAAATTTGGG + Intergenic
1103278065 12:119730768-119730790 TGTTGGAAAGGAAGACAGTTTGG - Intronic
1103870089 12:124085190-124085212 TTTATAAAAAGAAGGAAATTTGG + Intronic
1104793956 12:131503478-131503500 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1107354501 13:39552514-39552536 TTTATGTAAAATAGACACTTGGG - Intronic
1107661021 13:42639547-42639569 TTAATGAAAAGAAGGCAGAGCGG - Intergenic
1107760552 13:43673689-43673711 TTTTTGATAAGACTACAGTTTGG + Intronic
1108100937 13:46954279-46954301 TATATGAAAAGAAGAAAGGGAGG - Intergenic
1108307528 13:49153305-49153327 CTTCTCAAAAGAAGACATTTAGG - Intronic
1108384327 13:49885043-49885065 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1108581478 13:51832020-51832042 TTTATGCTAAGAACACAGATAGG + Intergenic
1109004193 13:56848827-56848849 TTTATGCAAAAAAGACAGCTTGG + Intergenic
1109059826 13:57601053-57601075 TATATGAAAAGTAAACATTTGGG - Intergenic
1109170552 13:59091968-59091990 ATTATAATAAGAAGGCAGTTTGG - Intergenic
1109339288 13:61034766-61034788 TTTGTGATAAGGAGACAATTTGG + Intergenic
1109431695 13:62245044-62245066 CTTATGAAAAGAAGGGATTTAGG - Intergenic
1109628154 13:65006006-65006028 CTTAACAAAAGAAGACATTTTGG - Intergenic
1109778295 13:67072997-67073019 TTTTTGAGAAGAAAACAGTTTGG + Intronic
1110907633 13:80912464-80912486 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1111444099 13:88322706-88322728 TTTATTAAAAGAAGAGATTATGG + Intergenic
1111861916 13:93718392-93718414 CTTTTCAAAAGAAGACATTTAGG - Intronic
1111974210 13:94948497-94948519 ATTATGAAAAGGAAACAGTTGGG + Intergenic
1112384839 13:98930100-98930122 TTAAAGAAAAGGAGGCAGTTAGG + Intronic
1112491684 13:99871276-99871298 TTTATGAAAAGAATAAAATGAGG - Intronic
1112682411 13:101782163-101782185 TTTAGGACAAGGAGCCAGTTGGG - Intronic
1112749889 13:102571423-102571445 TTTAGGAAAGGAATCCAGTTTGG + Intergenic
1112990578 13:105508900-105508922 CTTAGGAAAAGAAGTGAGTTTGG - Intergenic
1113001209 13:105639517-105639539 TTTATTAAACGAAAACACTTCGG - Intergenic
1113017405 13:105843287-105843309 TTTAGGAAGAGAAGATAGTGCGG + Intergenic
1113530245 13:111019294-111019316 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1114709310 14:24762396-24762418 CTTATCGAAAGAAGACATTTAGG - Intergenic
1114916396 14:27271936-27271958 TTTTTCAAAATAAGACACTTAGG + Intergenic
1115100208 14:29689312-29689334 TTTCTCAAAAGAAGACATTCAGG + Intronic
1115234841 14:31199323-31199345 TTTTTTAAAAGAAAACATTTTGG - Intronic
1115425827 14:33258092-33258114 CTTATGAAATTAAGAAAGTTAGG + Intronic
1115623103 14:35160510-35160532 TTTAAAAAAAGAAAATAGTTTGG - Intronic
1115640392 14:35332123-35332145 TTTATCACAAGAAGATCGTTTGG + Intergenic
1115691436 14:35848114-35848136 TTTTTAAAAAGAAAACAGTCTGG - Intronic
1115799888 14:36981041-36981063 CTTCTCAAAAGAAGACATTTAGG + Intronic
1116664307 14:47755179-47755201 TTTAAAAAAAAAAAACAGTTTGG + Intergenic
1116867552 14:50043286-50043308 TGCATGCAAAGAAGAAAGTTTGG + Intergenic
1117472579 14:56061089-56061111 GTTATGAAAAGAAGACACCACGG - Intergenic
1117762158 14:59040690-59040712 GTTCTGAAAAGAAGATAATTTGG + Intergenic
1118079569 14:62342736-62342758 TTAATGGAAAGAAGTCAGTCTGG + Intergenic
1118122004 14:62856354-62856376 TTTATAAAAGGAAGATAATTAGG - Intronic
1118544615 14:66872964-66872986 TTTATTTAAAAAAGACGGTTGGG + Intronic
1118705848 14:68479584-68479606 TTGATGAAGAGTAGACAGTCAGG - Intronic
1119084256 14:71725420-71725442 TTTATGAAGTCAAGAGAGTTTGG - Intronic
1119092097 14:71793119-71793141 TTTCTGTAAAGAAGCCAGCTGGG + Intergenic
1119581611 14:75788164-75788186 TATTTGAAAAGAAGACAGGCTGG + Intronic
1119962167 14:78871391-78871413 TTTAAGAAAAGATGACAATCTGG - Intronic
1120235993 14:81891658-81891680 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1120529806 14:85618439-85618461 TTTAAGAATAAAAAACAGTTTGG - Intronic
1121022013 14:90586027-90586049 TCTATTAAATGAAGAGAGTTAGG - Intronic
1121194334 14:92056432-92056454 TTTTTAAAAAGAAGAAAATTTGG + Exonic
1121378221 14:93433455-93433477 TTTATAAAAAGAACGCAGATTGG + Intronic
1121380589 14:93462623-93462645 ATAAGGAACAGAAGACAGTTGGG + Intronic
1121826588 14:97015152-97015174 TTAATGAAAAGCATACATTTTGG - Intergenic
1123885523 15:24723577-24723599 TTTATCCCAAGAATACAGTTTGG - Intergenic
1124674313 15:31670567-31670589 CTTCTCAAAAGAAGACATTTAGG - Intronic
1124810154 15:32928744-32928766 TTTATGACAAGATCACAGCTGGG + Intronic
1125830485 15:42712975-42712997 TTTCTGCAAAGAAGTCAGCTGGG + Intronic
1126631129 15:50737205-50737227 TATTTAAAAAGAAGACAGCTGGG - Intronic
1126668731 15:51096588-51096610 TTAATGAAAAGAAAAAAGTGGGG + Intronic
1126930319 15:53641133-53641155 TTTGTGAAAGGTAGAGAGTTGGG + Intronic
1128916663 15:71569058-71569080 TTTTAGAAAAGAAGGCATTTTGG - Intronic
1129223542 15:74150432-74150454 TTTGTGAAAAGACCACAGCTTGG - Intergenic
1130068129 15:80622904-80622926 TTTATGCAAAGAAGCCAGCTGGG - Intergenic
1130121128 15:81048551-81048573 TTTATGAAATTAAGCCTGTTTGG + Intronic
1130572535 15:85060773-85060795 TTTAAGAGATGAATACAGTTTGG - Intronic
1130805963 15:87322584-87322606 TTTATGAAAAGAAGATAACATGG + Intergenic
1131124793 15:89850245-89850267 TTTATGACAAGAAGACATCTAGG - Intronic
1131262888 15:90897715-90897737 TTTTTAAAAATAAGACATTTCGG - Intergenic
1131662559 15:94533873-94533895 TCACTGAATAGAAGACAGTTGGG - Intergenic
1131701750 15:94944226-94944248 TTTATAAATTGAAGAGAGTTTGG + Intergenic
1132328985 15:100997858-100997880 TTTATGATAAGAAGACATGGGGG + Intronic
1133195804 16:4169362-4169384 GTTACCAAAAGAAGACATTTCGG + Intergenic
1133502177 16:6376953-6376975 TTTATAAGAAGAAGGAAGTTTGG - Intronic
1133634169 16:7650389-7650411 TTTGTGAAAAGAACACAGGAAGG - Intronic
1133669955 16:8008800-8008822 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1133758253 16:8778456-8778478 TTTATAAGAAGAAGACAATCTGG - Intronic
1133852828 16:9522374-9522396 GTGATGGGAAGAAGACAGTTTGG + Intergenic
1133959693 16:10482678-10482700 TTTATGAAAAGATGACATGTTGG + Exonic
1134612478 16:15620441-15620463 TCTATGAAAAAAAGTAAGTTAGG - Exonic
1134802097 16:17094193-17094215 TTTATGAACAGAGAACACTTTGG - Intergenic
1135851554 16:25968367-25968389 CTCATGGAAAGATGACAGTTGGG - Intronic
1137865839 16:51895100-51895122 AATAAGAAAAGAAGACATTTAGG - Intergenic
1138815249 16:60196186-60196208 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1138854365 16:60670520-60670542 TTGATGAAAAGGAGACTCTTTGG + Intergenic
1140572166 16:76120232-76120254 TTTAGGAAAAGAAGAGTGTTAGG + Intergenic
1140589498 16:76335045-76335067 TTTATTCACAGAAGAGAGTTGGG + Intronic
1143433730 17:6906732-6906754 TTTGTGTATAGTAGACAGTTGGG + Intronic
1143752649 17:9041071-9041093 TTTAAAAAAAGAGCACAGTTTGG - Intronic
1144012972 17:11167803-11167825 TTTTTCAAAAGAAGACATTTAGG + Intergenic
1144276972 17:13679691-13679713 TAAATAAATAGAAGACAGTTGGG + Intergenic
1144352563 17:14411805-14411827 TTTATGAGAAGGAGACACATGGG + Intergenic
1144610554 17:16709713-16709735 CATATGAAAAGCATACAGTTTGG + Intronic
1144902190 17:18605680-18605702 CATATGAAAAGCATACAGTTTGG - Intergenic
1144928874 17:18840272-18840294 CATATGAAAAGCATACAGTTTGG + Intronic
1145911414 17:28545556-28545578 GATGTGAAAAGAAGACAGATTGG - Intronic
1146131721 17:30282825-30282847 TCAATGAAAAGAAGTCATTTGGG + Intronic
1146146073 17:30417764-30417786 ATGATGAATAGAAGACAGTATGG - Intronic
1148172161 17:45530709-45530731 TTTCTGGAAAGAAGCCAGCTGGG - Intergenic
1148357585 17:46985998-46986020 TTTATCCAAAGAGCACAGTTTGG - Intronic
1148363768 17:47036858-47036880 TTTCTGGAAAGAAGCCAGCTGGG + Intronic
1148513880 17:48197734-48197756 TTTATGAAAAGAAACCAGTTTGG - Intronic
1148622913 17:49048051-49048073 TTTATGGAAAGGAGACATTCTGG + Intronic
1148706284 17:49635933-49635955 TTTATGAAAAAGAGATACTTGGG - Intronic
1149149356 17:53541477-53541499 TTTAAGAAAAGGAGACAGCAAGG + Intergenic
1149190628 17:54057225-54057247 TTTATGGAAAGAATTAAGTTTGG + Intergenic
1149403082 17:56318713-56318735 TTTCTTAAAAGAATACAGATTGG - Intronic
1149570185 17:57666835-57666857 TTTCAAAAAAGAAGTCAGTTTGG - Intronic
1149782123 17:59406279-59406301 TTTATGGAAAGAAGAAAGGTAGG + Intergenic
1150097792 17:62393657-62393679 GTTATGAACAGAAGGCAGTTGGG + Intronic
1150403363 17:64877627-64877649 TTTCTGGAAAGAAGCCAGCTGGG - Intronic
1150878303 17:68994416-68994438 TTTAGGAAAGGCAGAGAGTTGGG - Intronic
1151570191 17:74922077-74922099 TTTATAAAGAGAAGTCAGGTTGG - Intronic
1152256064 17:79240154-79240176 TTTATGGACAGAAGACAGCTAGG - Intronic
1152909202 17:82988707-82988729 CTTCTCAAAAGAAGACATTTAGG + Intronic
1152979368 18:261285-261307 TTTAAGAAAAGTAGTCACTTAGG + Intronic
1153908035 18:9680872-9680894 TTTCTGCAAAGAAGCCAGCTAGG + Intergenic
1155403479 18:25463206-25463228 TTTAAGAAAAGAAGATAGAAAGG - Intergenic
1155618447 18:27747957-27747979 TTTATGAAAAGTGGAAATTTGGG + Intergenic
1155622972 18:27802245-27802267 TTTATCAAAAGAAGACATACAGG + Intergenic
1155659021 18:28225880-28225902 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1155748971 18:29396574-29396596 TTTAGGAAAAGAAAACAAATTGG - Intergenic
1156000928 18:32382888-32382910 TTTATTAAAGGAAAAGAGTTGGG + Intronic
1157122419 18:44924030-44924052 TTTCTGAAAAGCAGAAAATTTGG - Intronic
1157239075 18:45992617-45992639 TTTTTGAAAACAAGAAAATTTGG - Intronic
1157269729 18:46263275-46263297 TTAATTAAAAGAAGTCACTTAGG + Exonic
1158530260 18:58254701-58254723 TCTTTGAAAAGGAGACACTTTGG + Intronic
1158826260 18:61223679-61223701 TTTATGAAAAGAAGTTTATTTGG + Intergenic
1158925510 18:62254120-62254142 TTTTTGCAAAGAAGCCAGCTGGG + Intronic
1159226307 18:65541148-65541170 TTTATGAAATATAGACATTTAGG - Intergenic
1159388822 18:67761461-67761483 TTTAGGAAAGGAAGAGAGATGGG - Intergenic
1159816103 18:73075409-73075431 TTTATGAAAGGGAGGCAGTGAGG - Intergenic
1160052104 18:75443518-75443540 TTTATGAAAGGAAGATATCTGGG + Intergenic
1160089925 18:75817441-75817463 TTTGTGAAGAGAAGAAAATTTGG + Intergenic
1160359005 18:78255069-78255091 TTTAGGAAACAAAGTCAGTTCGG + Intergenic
1162214309 19:9120045-9120067 TTTTTCAAAAGAAGACATATAGG - Intergenic
1163295370 19:16408290-16408312 TTTCTGCAAAGAAGCCAGCTGGG - Intronic
1163636518 19:18439389-18439411 TATATGCAAATGAGACAGTTGGG + Intergenic
1164186855 19:22878063-22878085 TTGTTGAAAAAAAGTCAGTTGGG - Intergenic
1165953302 19:39486711-39486733 TCTCTCTAAAGAAGACAGTTGGG + Intronic
1167372107 19:49089129-49089151 TTTATCAAAAGCAAACAGATTGG - Intronic
1167400071 19:49260023-49260045 TTTCTGCAAAGAAGCCAGCTAGG - Intergenic
1168050445 19:53825761-53825783 TTTATAAGAAGAAGACAGGAGGG + Intergenic
924962763 2:47986-48008 ATTAGGAAAAGAAGACACTTTGG - Intergenic
925628211 2:5863044-5863066 TTTAGGAAAACAGGAAAGTTGGG + Intergenic
926744372 2:16138792-16138814 TTTTTAAAAAGAAGATGGTTGGG + Intergenic
927168398 2:20348496-20348518 TCTATAAAAAGGAGACAGCTTGG + Intronic
927539101 2:23891429-23891451 TTTTTGAAAAGAAGGAAGGTGGG + Intronic
929668321 2:43850945-43850967 CTGATGAAAAGAAGAGAGATGGG + Intronic
929837124 2:45413319-45413341 TTTATGAAAAGGGGAAGGTTGGG + Intronic
929837600 2:45420979-45421001 GTTATTAACAGAAGACATTTTGG + Intronic
929840577 2:45458140-45458162 TTTATGAAAATAAAAAATTTTGG + Intronic
930408404 2:50992123-50992145 TTTATGAATAGAAAACAGCCAGG - Intronic
930443743 2:51444044-51444066 TGTATAAAAATATGACAGTTTGG - Intergenic
930445787 2:51470582-51470604 TGTATGAAAGGGAGGCAGTTAGG + Intergenic
930539918 2:52692353-52692375 TTTATGTAAAGCAGAGACTTTGG + Intergenic
930684148 2:54289939-54289961 TTAATGGAAAGACGACTGTTTGG - Intronic
930870404 2:56165359-56165381 TTTAGAACAATAAGACAGTTTGG - Intergenic
931606267 2:64055800-64055822 TTTATAAAAATTAGAAAGTTGGG - Intergenic
932869769 2:75387039-75387061 CTTCTCAAAAGAAGACATTTAGG - Intergenic
933070183 2:77847151-77847173 TTTTTAAAAAGAAAACAGATGGG - Intergenic
933865325 2:86510744-86510766 TTTAGGAAAGGAAGCCAGCTTGG + Intronic
935030931 2:99321848-99321870 TTTATGAAATTAAGGCATTTTGG - Intronic
935031940 2:99331271-99331293 ACTATGAAAAGAAGCCAATTGGG + Intronic
935073952 2:99722350-99722372 TTGTTTAAAAGAAGAGAGTTTGG - Intronic
935778141 2:106489826-106489848 CTTATGAAAGGAGGACAGCTTGG - Intergenic
936387800 2:112045320-112045342 TGTAAGCAAAGAAGACAGTAGGG - Intergenic
936934731 2:117828111-117828133 CTTCTCAAAAGAAGACATTTAGG - Intronic
937327052 2:120996210-120996232 TTTACAAAAAGAAAACAGCTGGG + Intergenic
937499934 2:122467322-122467344 TTTGGGAAATGAAGACAGTGAGG + Intergenic
937502516 2:122495456-122495478 TTTCTACAAAGAAGACAGCTAGG + Intergenic
937626205 2:124046705-124046727 TACAAGAAAAGAAGACAATTGGG + Intronic
937830166 2:126411090-126411112 TTTATTACAAGAATACAGCTTGG - Intergenic
938364365 2:130722950-130722972 TTTCTGAAAATAAGACAATGAGG - Intergenic
938414724 2:131094479-131094501 TTTATGAAATAAAAACAGATGGG + Intergenic
938725059 2:134100612-134100634 TTTTTGAAAAAATGACAATTTGG - Intergenic
938877100 2:135543498-135543520 TTTCTGCAAAGAAGCCAGCTTGG + Intronic
939552939 2:143637855-143637877 CTTCTCAAAAGAAGACATTTAGG + Intronic
939837377 2:147147449-147147471 CTTCTCAAAAGAAGACATTTAGG - Intergenic
940603085 2:155885558-155885580 CTTCTCAAAAGAAGACATTTGGG + Intergenic
940826554 2:158418654-158418676 GTTCTGAAAAAAAAACAGTTGGG - Intronic
941368360 2:164634216-164634238 TTTGTGAGAAGAAGAAATTTGGG + Intergenic
941540566 2:166778378-166778400 TTTTTGAAATGAAGATATTTTGG + Intergenic
941566845 2:167119181-167119203 TTTATGAAAAGAAGAAAAATAGG + Intronic
941592018 2:167431790-167431812 TCTAGGAAAAGAAGATAGCTTGG + Intergenic
941716780 2:168772474-168772496 TTTATGAAAAGAATATGGGTAGG - Exonic
941821915 2:169852042-169852064 TTTATGATCAGAAGACAATGTGG + Intronic
942226774 2:173823439-173823461 TTTATAAAAAGGAGACGTTTGGG - Intergenic
942486071 2:176441069-176441091 TTTATAAAAAGAGGAAATTTGGG - Intergenic
942591134 2:177547947-177547969 TTCATGAGAAGCAGACAATTGGG - Intergenic
943036475 2:182752223-182752245 TTTATAAAATGAAGACCTTTTGG + Intronic
943039038 2:182781750-182781772 CTTCTCAAAAGAAGACATTTAGG - Exonic
943215964 2:185035895-185035917 TTTATGAAAAATAAAGAGTTGGG - Intergenic
943546032 2:189279746-189279768 TTTACAAGAACAAGACAGTTAGG + Intergenic
943911340 2:193571907-193571929 CTTATGAAAAGAAGCCATGTGGG - Intergenic
944125144 2:196283992-196284014 TGTATGAAAAGCAGAGAGGTGGG - Intronic
944306056 2:198181197-198181219 TTTATGAGAAGAAGAGACTCCGG - Intronic
944644812 2:201768308-201768330 TTTCTTAGAAGAAGGCAGTTAGG - Intronic
945952688 2:216054634-216054656 TTTCAGAAAAGAAGTCAGTGGGG - Intronic
946667018 2:222061108-222061130 ATCATGAAAAAAACACAGTTTGG + Intergenic
946833929 2:223753112-223753134 TTGAAGAGAAGAAGACATTTAGG - Intronic
947127409 2:226884298-226884320 TATGTAAAATGAAGACAGTTGGG + Intronic
947775579 2:232706474-232706496 TCTATGAAAATAAAAAAGTTTGG + Intronic
948040788 2:234900086-234900108 TTTCTGGAAAGAAGTCACTTAGG + Intergenic
1168772480 20:424272-424294 TATCTGAAAAGTGGACAGTTGGG + Intronic
1169878283 20:10321215-10321237 TATTTGAAAAAAAGACAGTTGGG + Intergenic
1170225610 20:13988683-13988705 TTTTTGAAAAGAAGTCAGCTGGG + Intronic
1170238738 20:14138176-14138198 ATTATGGAAAGAAAACAGTATGG + Intronic
1170255739 20:14341335-14341357 ATTGTGTAAAGAAAACAGTTTGG + Intronic
1172574454 20:35996935-35996957 TTTATGAAGAGAAGAAAGTCTGG - Intronic
1175025530 20:55898514-55898536 TTTAGGAAAAGAAGCCATTTCGG - Intergenic
1175297065 20:57915730-57915752 TTTCTTAAAAGAAGACACGTAGG + Intergenic
1175732276 20:61362098-61362120 TTTGTGAATAGGAGACATTTGGG + Intronic
1176877199 21:14143429-14143451 TATATCAACAGAAGAGAGTTGGG - Intronic
1177178809 21:17723160-17723182 TTTATAAAAAGAAAAAAATTAGG + Intergenic
1177359099 21:20045925-20045947 TTGGGGAAAAGAAGACACTTGGG - Intergenic
1177858320 21:26424338-26424360 TTTAGGAGACGAAGACAGTGGGG + Intergenic
1177873229 21:26598948-26598970 TTTAAAAAAAAAAGAAAGTTGGG + Intergenic
1177902811 21:26937670-26937692 TTTAAGAAATGTATACAGTTTGG + Intronic
1178621311 21:34179157-34179179 TTTATGAAAATAAGAGAGATGGG - Intergenic
1178979360 21:37249347-37249369 TTTCAGAAAAGATGACAGCTGGG + Intronic
1180651302 22:17379290-17379312 TTTAAGGAAAGAAGAGAGTTTGG + Intronic
1182210716 22:28674862-28674884 TTTCTGTAAAAAAGACAGCTGGG - Intronic
1182258277 22:29053669-29053691 TTTTTTGAAAGAAGTCAGTTTGG - Exonic
1182655988 22:31890341-31890363 TTTATTAAAATAACACATTTGGG + Intronic
1182888173 22:33793783-33793805 CTTATGAAAAAAAAAAAGTTGGG - Intronic
1185160555 22:49226069-49226091 TTTCTGCAAAGAAGTCAGCTTGG - Intergenic
949552949 3:5127059-5127081 ATTAGGAAAAGAAGATATTTGGG + Intronic
950975789 3:17242872-17242894 TTTATTACAAGTAGACAGTATGG + Intronic
951093262 3:18599529-18599551 TTTTTGAAAAGATTGCAGTTAGG - Intergenic
951265755 3:20563975-20563997 CTTATCAAAAGAATAAAGTTTGG + Intergenic
951714995 3:25632917-25632939 TTTAAAAAAATAAGACATTTTGG + Intronic
952246855 3:31603864-31603886 TTAATTAAAAGCAGACAGTAAGG + Intronic
952273586 3:31856269-31856291 TTTATTAAAACAATAAAGTTTGG - Intronic
953509454 3:43520799-43520821 TTTTTGAAAATAAGTCAGCTAGG + Intronic
953997494 3:47531361-47531383 TTTCTGCAAAGAAGGCAGCTGGG + Intergenic
954470799 3:50693253-50693275 TTTCTGCAAAGAATACAGTTGGG + Intronic
954572418 3:51653134-51653156 CTTTTCAAAAGAAGACATTTAGG + Intronic
955018463 3:55095133-55095155 TCTGGGAAAAGAAGAAAGTTGGG - Intergenic
955210875 3:56939798-56939820 TTTATGATAGGAGGACAGATAGG + Intronic
955236613 3:57144958-57144980 TTCCTGACAAGAAGACAGCTTGG + Intronic
955960133 3:64332103-64332125 TTTATGATGAGAAGACACTCTGG - Intronic
956245068 3:67173841-67173863 TTAATGAGAAGAAAACAGTCAGG + Intergenic
956629552 3:71302564-71302586 TTTTTTAAAAGAAGACAAGTGGG - Intronic
956657999 3:71570648-71570670 TTGAAGAAAAGAACAGAGTTTGG + Intronic
956691941 3:71886698-71886720 TTTTTGAAAAGAAGAATATTTGG + Intergenic
956844364 3:73168745-73168767 TTTGCTAAAAGAAGACAGTAGGG - Intergenic
956889151 3:73593362-73593384 TTTATGAAAGGAAGACTTTGAGG + Intronic
957141614 3:76366181-76366203 TCTCTGAAAAGGAGACTGTTGGG - Intronic
957423642 3:80006092-80006114 GCTATGAAAAGAATACAGTGCGG - Intergenic
958498646 3:94876915-94876937 TTTAAGAAAAAAAGAAAGTATGG + Intergenic
958541710 3:95484500-95484522 TCTATAGAAAGAAGACATTTAGG - Intergenic
958670078 3:97192413-97192435 TTTCTCAAAAGAAGACGGTCAGG - Intronic
959146429 3:102551370-102551392 TTTCTGAAAACAGGACATTTAGG - Intergenic
959156964 3:102678815-102678837 TTTTTGAACTGAAGGCAGTTAGG - Intergenic
959179473 3:102960121-102960143 TTTATCAAAAGAAGACATACAGG - Intergenic
959191345 3:103115385-103115407 TTTATAAAAAGAAGACACAAAGG + Intergenic
959384740 3:105689240-105689262 TGAATGAAAACAGGACAGTTAGG + Intronic
959582624 3:107997449-107997471 TGTCAGAAAAGAAGACAGTGAGG + Intergenic
959748002 3:109800087-109800109 CTTTTCAAAAGAAGACATTTAGG + Intergenic
959828332 3:110829256-110829278 TTTATTAAAAGAAGAAAAATGGG - Intergenic
959868322 3:111297729-111297751 TTACTGAAAAGAAGACAGAGAGG - Intronic
960157260 3:114308723-114308745 TTCAGGAAGAGACGACAGTTTGG + Exonic
960175008 3:114506800-114506822 TTTATTAAAAGTAGAGAGGTGGG - Intronic
960889085 3:122427424-122427446 TGGATGAAAAGAGGACTGTTAGG - Intronic
962204168 3:133421493-133421515 CTTATGAAAAGAGGAAAATTTGG - Intronic
962419679 3:135216937-135216959 TTCAAGGAAAGAAGGCAGTTCGG + Intronic
962480110 3:135790671-135790693 CTTCTCAAAAGAAGACATTTAGG - Intergenic
962639035 3:137364319-137364341 TTTCTGCAAAGAAGCCAGCTGGG - Intergenic
963109755 3:141678157-141678179 TTTGGGAAAAAAAGAGAGTTAGG + Intergenic
963961681 3:151316156-151316178 TTTATCAAAATGAGACAGTTGGG + Intronic
964690589 3:159445231-159445253 CTTCTCAAAAGAAGACATTTAGG + Intronic
964692996 3:159474312-159474334 TTTCTGAAAACAACACAATTAGG + Intronic
964976787 3:162630909-162630931 TTTGGGAAAACAATACAGTTAGG + Intergenic
965230415 3:166043842-166043864 TGGAGGAAAAGAAGGCAGTTGGG + Intergenic
965527404 3:169735692-169735714 CTTTTCAAAAGAAGACATTTAGG + Intergenic
965631683 3:170739813-170739835 TTTATGAAAAAAATAAAGATTGG - Intronic
966222030 3:177560600-177560622 TTAATGAAAAGGAGACATTTTGG + Intergenic
966305369 3:178527154-178527176 TTTATGAAATAGAGACACTTTGG - Intronic
966675699 3:182585985-182586007 TTTCTGAATAGAAGACAATGAGG + Intergenic
967297451 3:187979135-187979157 TTTTTGAAATGAAGAAACTTAGG + Intergenic
967764244 3:193260551-193260573 CTTCTGAAAAGAAGACATTCAGG + Intronic
967938991 3:194751857-194751879 TTTATAAACACAAGACACTTTGG + Intergenic
968388360 4:166636-166658 CTTCTCAAAAGAAGACATTTAGG - Intergenic
968401364 4:301071-301093 CTTCTCAAAAGAAGACATTTAGG + Intronic
968408291 4:362164-362186 CTTCTCAAAAGAAGACATTTAGG - Intronic
968838965 4:2986653-2986675 TGTATGAAAAAAAGACACTGAGG - Intronic
969063485 4:4458757-4458779 TCTATGAAATGCAGACAATTAGG - Intronic
969557394 4:7921823-7921845 TTTTTAAAAAGAAGACACATAGG + Intronic
969931902 4:10638890-10638912 CTTATGAAAAGAAGAAATTTGGG - Intronic
969998206 4:11336666-11336688 TCCATTAAAAGAGGACAGTTGGG + Intergenic
970281151 4:14457154-14457176 TCTATGATAAGAAGAGAGGTAGG - Intergenic
970410815 4:15806382-15806404 TTTGCAAAAAGAACACAGTTTGG + Intronic
970636402 4:18014305-18014327 TTCATGAAAAAAAGACAAATGGG + Intronic
970735072 4:19156597-19156619 TTGATGAAAAGAAGGCACTCTGG + Intergenic
970749944 4:19346772-19346794 TTTATGAAATGAGGGCACTTTGG + Intergenic
970823175 4:20243095-20243117 TTAATTAAAAGAAGGCAGGTTGG - Intergenic
970979856 4:22083497-22083519 TTTCTGAGAACAGGACAGTTGGG + Intergenic
971443065 4:26710815-26710837 CTTCTCAAAAGAAGACATTTAGG - Intronic
971615103 4:28779084-28779106 TCTCTGAAAAGAAGACACTCTGG + Intergenic
971856139 4:32045918-32045940 CTTCTGGAAAGAAGACATTTAGG + Intergenic
971856361 4:32049353-32049375 TTTTTGAAAAAGAAACAGTTTGG - Intergenic
972359288 4:38312738-38312760 TTTAGTAATAGAAGACAGATAGG + Intergenic
972513685 4:39793414-39793436 TTTAAGAAAATAAGACTGTTAGG + Intergenic
972736056 4:41842563-41842585 CTTATGAAAAGAAGGCTGTGTGG - Intergenic
972821224 4:42704061-42704083 TTTATGCAAAGAACACAAATGGG + Intergenic
972942259 4:44210712-44210734 TTTATGATAGGAAGACAGGAGGG + Intronic
973126958 4:46598181-46598203 TTTATGAACTGAAGACAATTGGG + Intergenic
973629657 4:52808168-52808190 TTTTTAAAAAAAAGAAAGTTCGG + Intergenic
974029192 4:56760816-56760838 TTTATGAAATTAAGGCATTTCGG - Intergenic
974201873 4:58653292-58653314 TTTATAAAAAGAAAACTCTTTGG - Intergenic
974883983 4:67793722-67793744 TTTAGAAAAAGAAGGGAGTTTGG + Intergenic
974947694 4:68547780-68547802 CTTCTCAAAAGAAGACATTTAGG + Intronic
975514172 4:75226694-75226716 CTTCTCAAAAGAAGACATTTAGG + Intergenic
975827574 4:78335964-78335986 TTTCTAAAAAATAGACAGTTGGG + Intronic
977451185 4:97200269-97200291 TATAGGAAAAGGAGCCAGTTTGG + Intronic
977653660 4:99497464-99497486 CTTCTCAAAAGAAGACATTTAGG + Intergenic
977829886 4:101577833-101577855 CTTCTCAAAAGAAGACATTTAGG + Intronic
977958640 4:103059134-103059156 TTTATGGGAAAAAGAGAGTTGGG + Intronic
978338465 4:107695927-107695949 CTTCTCAAAAGAAGACACTTAGG + Intronic
978387849 4:108193654-108193676 TTTAAGAAGACAAGAAAGTTAGG - Intergenic
978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG + Intronic
978592590 4:110341914-110341936 TTTCTGAAAAAATGACAGTAAGG - Intergenic
978961397 4:114683589-114683611 TCTATGAAAATAAAAAAGTTTGG + Intergenic
979123610 4:116936503-116936525 TTCATGAAAGGAAGTCAGTTTGG - Intergenic
979154559 4:117367589-117367611 TTTCAGTAAACAAGACAGTTTGG - Intergenic
979286563 4:118932144-118932166 TATATGAATAGAAGACTGCTTGG - Intronic
979363232 4:119789193-119789215 TTTATGGAAAGAAGAAACATAGG - Intergenic
979375154 4:119938008-119938030 TTTCTGAAAGGAAGAGAGATAGG + Intergenic
979491027 4:121328096-121328118 CTAATCAAAAGAAGAAAGTTTGG - Intergenic
980549597 4:134317139-134317161 TTTCTTAAAATAAGACAGTGAGG + Intergenic
980568055 4:134571641-134571663 CTTTTTAAAAGAAGACATTTAGG - Intergenic
980677659 4:136109940-136109962 TTTCAAAAAAGAATACAGTTAGG + Intergenic
980694239 4:136336141-136336163 TTTATGAATAGAATAAAGTGTGG + Intergenic
980812735 4:137903848-137903870 TTTAAGAAGATAAGACAGTGGGG + Intergenic
982166411 4:152617597-152617619 TTAATGCAAAGAAAACTGTTGGG + Intergenic
982687091 4:158503836-158503858 TTTATAAGAAGAAGAGAGATTGG - Intronic
982696644 4:158609796-158609818 TATATGGAAAGAAGACAGTCAGG - Intronic
982752848 4:159183033-159183055 TATATGCAAATAAGCCAGTTGGG - Intronic
982752982 4:159184528-159184550 CTTCTCAAAAGAAGACATTTAGG - Intronic
982921528 4:161279791-161279813 TTAATGAAAATAAAACATTTAGG + Intergenic
983161510 4:164421430-164421452 TTTATGAGTTGAAGAGAGTTAGG - Intergenic
983376578 4:166936146-166936168 TCTAAGAAAATAAGCCAGTTTGG - Intronic
983443053 4:167812794-167812816 TTTATGAAAAGAAAATACTGAGG + Intergenic
983792889 4:171820505-171820527 TTGCTGAAAACAAAACAGTTGGG - Intronic
983793371 4:171826938-171826960 TTTAGGAAAAGAACACAAGTAGG - Intronic
984434999 4:179698351-179698373 TTTGTGAAAATAAGACTGTGGGG + Intergenic
984596840 4:181678564-181678586 TTTATGGAAAGAAAATAGATAGG + Intergenic
985080756 4:186261743-186261765 GTAATGAAAAGAGGACATTTCGG + Intergenic
985425191 4:189823107-189823129 TTTCTGGAAGGAAGACAATTAGG + Intergenic
986489891 5:8278669-8278691 TGCATGTAAAGAAGACATTTTGG + Intergenic
986556226 5:9012263-9012285 TTGTTGAAAAAAAGACAGTGAGG - Intergenic
986918129 5:12649882-12649904 TTTATAAAAATAGGAAAGTTTGG + Intergenic
987057004 5:14203164-14203186 TTTAAGAACAGATTACAGTTTGG - Intronic
987149040 5:15020395-15020417 TTTATGAAAAAAAGGCGGTCAGG + Intergenic
987257534 5:16171751-16171773 GTTATCAAGTGAAGACAGTTTGG + Intronic
987665112 5:20927040-20927062 TTTATCAAAAGAAGGCATATAGG - Intergenic
987820884 5:22964987-22965009 CTTCTCAAAAGAAGACAGATAGG - Intergenic
988057919 5:26124484-26124506 TTTATAAAAATAAAACAGTGTGG - Intergenic
988061185 5:26172696-26172718 TTTATGAAATAAATACATTTTGG + Intergenic
988369062 5:30343936-30343958 TTTATGCAAAGAAGATAACTTGG + Intergenic
988757575 5:34275140-34275162 TTTATCAAAAGAAGGCATATAGG + Intergenic
989407124 5:41074062-41074084 CTTTTCAAAAGAAGACATTTAGG - Intergenic
989970969 5:50523593-50523615 TTTCTGAAAATATGACATTTTGG + Intergenic
990467150 5:56081263-56081285 TTTAAGGATAGAAGACACTTGGG - Intergenic
990574805 5:57114114-57114136 TTGATAAAAATAAGACAGTGAGG - Intergenic
990751241 5:59019079-59019101 ATCATGAAGAGAAGCCAGTTGGG - Intronic
991191779 5:63882893-63882915 TTCATAAAATGAAGACAGTCAGG + Intergenic
991431903 5:66556877-66556899 TTTCTGCAAAAAAGCCAGTTGGG + Intergenic
991449578 5:66737832-66737854 GATATGAAAAGAAGAGAGTGAGG + Intronic
991762636 5:69935605-69935627 TTTATCAAAAGAAGACATGCAGG + Intergenic
991784690 5:70182516-70182538 TTTATCAAAAGAAGACATGCAGG - Intergenic
991841864 5:70810645-70810667 TTTATCAAAAGAAGACATGCAGG + Intergenic
991877136 5:71182896-71182918 TTTATCAAAAGAAGACATGCAGG - Intergenic
992925605 5:81582891-81582913 TATGTTAAAAGAAGACAGTAAGG - Intronic
993097881 5:83501814-83501836 TTTCTGCAAAGAAGCCAGCTAGG + Intronic
993500845 5:88665181-88665203 TTTATGAAAAGGCGACAATGGGG + Intergenic
993825614 5:92682396-92682418 TTGATGAAGAGAAGAAAGTTTGG + Intergenic
994344285 5:98666054-98666076 CTTCTCAAAAGAAGACATTTAGG + Intergenic
994610987 5:102038916-102038938 TATATGAAAAGGAGACTCTTTGG - Intergenic
996309086 5:122082683-122082705 AATATAAAAAGTAGACAGTTGGG + Intergenic
996445317 5:123542084-123542106 TATATAAAAAGAAAACAGATGGG - Intronic
997448352 5:133960346-133960368 TTTATGAAATGAAAACAGAGGGG - Intronic
998755843 5:145378843-145378865 TTGAAGAAAAGAAGACATTCTGG + Intergenic
999075909 5:148795134-148795156 TGAGGGAAAAGAAGACAGTTTGG + Intergenic
999791921 5:154948238-154948260 TTTATGAAAATGATACAGTGGGG - Intronic
1000235019 5:159349766-159349788 TTTGTACAAAGAAGTCAGTTTGG + Intergenic
1000409944 5:160927822-160927844 ATTATGAAAATAACACAGTGAGG + Intergenic
1000502955 5:162075667-162075689 TTTAGGAAAAGAATAAAATTTGG - Intronic
1000531954 5:162433922-162433944 TTAGTAAAAAGAACACAGTTGGG - Intergenic
1001091388 5:168743992-168744014 TTTAAGAAAAGAAGCCGGCTGGG + Intronic
1001354042 5:171003219-171003241 TGTATGTAATGAAAACAGTTAGG + Intronic
1001852301 5:174980223-174980245 TTTAACATAAGAAGACAGTCAGG + Intergenic
1002318904 5:178363541-178363563 TGTCTGAAAAGGAGACATTTGGG - Intronic
1004012438 6:11702579-11702601 TGAATGAAAAGAGGAGAGTTTGG + Intergenic
1004774054 6:18822498-18822520 ATTTTGAAAAGAACATAGTTGGG + Intergenic
1005477405 6:26221151-26221173 TTCATGAAAAGAAGAAAGTCCGG - Intergenic
1005534757 6:26744192-26744214 TTTATGACAAGAAGACCTCTCGG + Intergenic
1005752781 6:28898897-28898919 TTTATGAAAAGTAAACTCTTGGG + Intergenic
1006593644 6:35176756-35176778 TTTATGAAAACCAGTCAGGTAGG + Intergenic
1006771907 6:36560733-36560755 TTCATGAAGAGAGGACAGGTAGG - Intergenic
1007998379 6:46333095-46333117 CTTCTCAAAAGAAGACATTTAGG - Intronic
1008113116 6:47515147-47515169 TTTATGATAAAAAGATAATTAGG + Intronic
1008404808 6:51107146-51107168 GTTATGGAAAGAAGAAAGTTAGG + Intergenic
1008482126 6:51996657-51996679 TAAATGAAAAGGAAACAGTTTGG - Intronic
1008701369 6:54104727-54104749 TGTAAGAAAAGAAGACAGTTTGG - Intronic
1008707218 6:54177399-54177421 ATTGTCAAAAGAAGACATTTAGG + Intronic
1008716339 6:54294660-54294682 TTTGAGATAAGAAGACATTTTGG + Intergenic
1009239247 6:61163753-61163775 GTTCTCAAAAGAAGACATTTAGG - Intergenic
1009563910 6:65285543-65285565 TTTATGAATAGAAGATAGCATGG - Intronic
1010471744 6:76236095-76236117 TTTAAGAAAAGAAAAAAGTAGGG + Intergenic
1010484706 6:76396145-76396167 TTTCTCAAAAGAAGACAAGTGGG + Intergenic
1010542879 6:77113991-77114013 TTTATGATAAGAAGATATTTGGG - Intergenic
1011257564 6:85438682-85438704 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1012098155 6:94993059-94993081 GTTATTGAAAGAAGAGAGTTGGG - Intergenic
1012309736 6:97708209-97708231 ATTATGAAAAAAAGTCTGTTGGG - Intergenic
1013090818 6:106899099-106899121 TTTATCCAAAGAAAAAAGTTAGG - Intergenic
1013278458 6:108609956-108609978 TTTTTGAAAAGAAAACAGTTGGG + Intronic
1013432716 6:110069460-110069482 TCTACTAAGAGAAGACAGTTTGG - Intergenic
1014888491 6:126812533-126812555 TTTAAAAAATGAAGACATTTGGG - Intergenic
1015000164 6:128204619-128204641 TTTCTCAAAAGAAGACATATAGG + Intronic
1015292542 6:131553877-131553899 CTTCTAAAAAGAAGACATTTAGG - Intergenic
1015730123 6:136338847-136338869 TTTTTGGAAAGAAAACATTTTGG + Intergenic
1016110302 6:140215022-140215044 TTTCTGCAAAAAAGACAGTTGGG + Intergenic
1016234543 6:141847379-141847401 TAAAAGAAAAGAAGACAATTTGG + Intergenic
1016687782 6:146900818-146900840 CTTATGAAAAGAACATAGTCTGG + Intergenic
1017185884 6:151599880-151599902 TGGATGAAAAGAAGAGAGTTAGG + Intronic
1017310605 6:152972374-152972396 TTTCTGAACAGAAGCCAGTGGGG + Exonic
1017615900 6:156246100-156246122 TTTATGAATAGATGACAGAAAGG + Intergenic
1018104756 6:160474126-160474148 ATTATAAAAAGAACACAATTAGG + Intergenic
1018200861 6:161394159-161394181 ATTTTGAAAAGAAGAAAGTAAGG + Intronic
1019010161 6:168838650-168838672 TTTATTAAAACAGGACAGTAGGG - Intergenic
1019212830 6:170420316-170420338 TTTATGAAAAGCTGACAGCTCGG - Intergenic
1019812816 7:3176927-3176949 CTTATGAGAAGAAGAAAATTTGG + Intergenic
1020108228 7:5432637-5432659 CTTATAAAAAGAGGACATTTGGG + Intronic
1020647451 7:10832150-10832172 CTTCTGAAAAGAAGACATTCAGG + Intergenic
1020872100 7:13644157-13644179 TTTAAGAAAAGAAGCCAGAAAGG + Intergenic
1020917928 7:14220647-14220669 TTTCTGTAAAGAAGCCAGCTAGG + Intronic
1020920294 7:14255069-14255091 GTTATGAAAAAAAGACAAATGGG + Intronic
1020985883 7:15133901-15133923 TTTGGGAAAAGAAGCCAGTTTGG - Intergenic
1021070888 7:16238834-16238856 TTTAGAAAAAGAAGCCATTTAGG + Intronic
1021282221 7:18735023-18735045 CTTCTCAAAAGAAGACATTTAGG - Intronic
1021381055 7:19966886-19966908 TTTATGGAAAAGAAACAGTTGGG - Intergenic
1021859462 7:24891908-24891930 TTGATGAAGGGAAGAAAGTTGGG + Intronic
1021923524 7:25512269-25512291 TTTAAGCACACAAGACAGTTTGG + Intergenic
1022043333 7:26601909-26601931 TCTATCAAATGAAGAGAGTTAGG - Intergenic
1022065012 7:26845629-26845651 CTTATGAAAAGAAGAGTGCTAGG + Intronic
1022137708 7:27465256-27465278 ATTTTGAAAAAAAGACACTTTGG + Intergenic
1022952104 7:35349000-35349022 CTTAAGAAAAGAAGATAGCTTGG + Intergenic
1023018741 7:35990579-35990601 TTTTTGCAAAGAAGCCAGCTGGG - Intergenic
1023781420 7:43659609-43659631 TTTATAAAAATAAAACAATTTGG + Intronic
1024846770 7:53653784-53653806 TATATGAAAAGAGGATGGTTTGG - Intergenic
1026745479 7:73008106-73008128 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1026749130 7:73036046-73036068 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1026752778 7:73064191-73064213 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1026756429 7:73092317-73092339 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1026917307 7:74128574-74128596 TTTCTGAAAACAAGCCAGCTGGG + Intergenic
1027031590 7:74892780-74892802 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1027090976 7:75301105-75301127 ATTCTGAAAAGAAGGTAGTTTGG - Intergenic
1027094621 7:75329077-75329099 ATTCTGAAAAGAAGGTAGTTTGG - Intergenic
1027098262 7:75357004-75357026 ATTCTGAAAAGAAGGTAGTTTGG - Intergenic
1027324720 7:77038603-77038625 ATTCTGAAAAGAAGGTAGTTTGG + Intergenic
1027551707 7:79605755-79605777 TCTATGAAAAAAAGACACCTAGG + Intergenic
1027756280 7:82216564-82216586 TTTTTGAAAAAAGGAAAGTTTGG - Intronic
1027887412 7:83927063-83927085 TTTCTAAAAAGAAGGCAGCTGGG + Intergenic
1027898621 7:84079557-84079579 CTTCTCAAAAGAAGACATTTAGG + Intronic
1028306321 7:89269850-89269872 CTTCTCAAAAGAAGACATTTAGG - Intronic
1028402514 7:90439519-90439541 TTTATGCAAAGAAGAAAGATTGG + Intronic
1028426158 7:90691667-90691689 ATTCTGAGAAGAAGACAGTAGGG + Intronic
1029230437 7:99063451-99063473 TTTAAAAAAAGAAGTTAGTTGGG - Intronic
1029399374 7:100333904-100333926 ATTCTGAAAAGAAGGTAGTTTGG - Intergenic
1029674091 7:102054664-102054686 TTTCTGCAAAGAAGCCAGCTGGG + Intronic
1030408719 7:109147346-109147368 ATTATGTATACAAGACAGTTAGG + Intergenic
1030745418 7:113160113-113160135 TTTTTTAAAAGAACACAGATGGG + Intergenic
1031006618 7:116480274-116480296 CTTCTCAAAAGAAGACATTTAGG - Intronic
1031032560 7:116750775-116750797 CTTCTCAAAAGAAGACATTTAGG + Intronic
1031157776 7:118130395-118130417 TTCATGAAAAGGAGAAATTTTGG + Intergenic
1031479723 7:122264138-122264160 TTTCAGAAAAGAAGGCAGATTGG + Intergenic
1031583281 7:123504147-123504169 TTTATAAAGAAAAGACATTTAGG + Intronic
1031832836 7:126648303-126648325 TTAATGAAAATCAGACAGATAGG - Intronic
1032005291 7:128297350-128297372 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1032696933 7:134345183-134345205 CTTATGAAAAGTAGAGAGGTGGG + Intergenic
1032995148 7:137436805-137436827 TTTATGAGAAGAACTCAGATTGG - Intronic
1033021187 7:137725827-137725849 TTAAAGAGAAGAAGAGAGTTAGG - Intronic
1033301558 7:140190690-140190712 TTAAAGAAAAGAACAAAGTTAGG + Intergenic
1033369947 7:140698465-140698487 GTTATGAAGAGAATACAGCTGGG + Intronic
1033941706 7:146662950-146662972 GTTATGCAATGAAGACAATTTGG - Intronic
1033954034 7:146821676-146821698 CTTCTCAAAAGAAGACATTTAGG + Intronic
1034012809 7:147548392-147548414 CTTTTCAAAAGAAGACATTTAGG - Intronic
1034076720 7:148238954-148238976 TTAAGGAAAATAACACAGTTTGG + Intronic
1034244396 7:149633691-149633713 TAGATGAAAAGAAGTCAGTTGGG - Intergenic
1034699311 7:153082905-153082927 TTTAGGAAAATAATTCAGTTTGG - Intergenic
1034979109 7:155464984-155465006 TTTTTTTAAATAAGACAGTTTGG + Intergenic
1035215112 7:157360036-157360058 ATTATAAGACGAAGACAGTTGGG + Intronic
1035435385 7:158855868-158855890 TTTATCAAAAGACGACATATGGG + Intergenic
1035765260 8:2100220-2100242 TTCATTAAAAGAAGAAAGGTAGG - Intronic
1035935645 8:3834922-3834944 CTTCTCAAAAGAAGACATTTAGG + Intronic
1036128581 8:6086560-6086582 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1036541177 8:9713119-9713141 TTTATGAAATGAAGACAAAGTGG + Intronic
1036554435 8:9846120-9846142 TTTCTGTAAAGAAGGCAGCTGGG - Intergenic
1036985620 8:13526338-13526360 TTTCTGTAAAAAAGACTGTTGGG + Intergenic
1037462233 8:19122760-19122782 TTAAGCAAAAGAAGCCAGTTTGG - Intergenic
1037493208 8:19415167-19415189 TCTATAAAAAGAAGAAAGTGAGG + Intronic
1038001240 8:23393173-23393195 TTTCTGCAAAGAAGTCAGCTGGG - Intronic
1038402001 8:27290728-27290750 TTTCTGCAAAGAAGCCAGCTAGG - Intronic
1038804742 8:30779868-30779890 TTTATGACAATAGCACAGTTAGG + Intronic
1039597257 8:38801744-38801766 TTTTTGCAAAGAAGGCAGCTGGG + Intronic
1040018611 8:42720505-42720527 TTGCTGTAAAGGAGACAGTTTGG - Intronic
1040557166 8:48490878-48490900 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1040765132 8:50900518-50900540 ATTCTGAAAAGAAAACAATTTGG + Intergenic
1040770774 8:50972544-50972566 TTTAGGAAAAGAGGAAAGCTGGG + Intergenic
1040976599 8:53200256-53200278 TTCATTAAAAGAAAATAGTTTGG + Intergenic
1041316713 8:56570939-56570961 AATATAAAAATAAGACAGTTGGG - Intergenic
1041400982 8:57445166-57445188 TTCATGAAAAGAACTCAGTCTGG + Intergenic
1041575195 8:59386182-59386204 TTTCTCAAAAGAAGACATTTAGG + Intergenic
1041959834 8:63600425-63600447 TTTATGAAATGAGGACATTCAGG + Intergenic
1042477264 8:69262640-69262662 TTTCTGAAAAGAAAACAGTTTGG + Intergenic
1043081847 8:75775871-75775893 TTTAAGAAATTAAGAGAGTTGGG - Intergenic
1043192710 8:77246930-77246952 TTTAATAAAAGAAAAAAGTTTGG - Intergenic
1043233796 8:77835062-77835084 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1043281876 8:78478427-78478449 TTAATGAAAAGAACACACCTGGG - Intergenic
1043997164 8:86832323-86832345 TTTCTGAAAAGAAACCAGTTAGG - Intergenic
1044273053 8:90269445-90269467 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1044570624 8:93713992-93714014 TTTCTACAAAGAAGTCAGTTCGG + Intronic
1044646180 8:94445669-94445691 TTTATGAAAAGAATGTATTTAGG + Intronic
1045070269 8:98496535-98496557 TTTCTGCAAAGAAGTCAGCTGGG - Intronic
1045276095 8:100707290-100707312 TTTAAAAAAAAAAGACAGCTGGG + Intronic
1045694102 8:104788416-104788438 TCTCTGAAAATAAAACAGTTGGG - Intronic
1045735437 8:105290746-105290768 TATATAAAGAGAAAACAGTTTGG + Intronic
1045994421 8:108345647-108345669 TTTCTGAAAATATGTCAGTTTGG + Intronic
1046078690 8:109343628-109343650 TTTATTAAAATAACACATTTAGG - Exonic
1046183378 8:110682059-110682081 TTTAAGAAAAGCAAACTGTTTGG - Intergenic
1046682171 8:117182619-117182641 TTTATGAAGAGGTGACATTTGGG + Intergenic
1048163110 8:132038829-132038851 TCTCTGAAAAGAAAACACTTTGG + Exonic
1050041532 9:1500024-1500046 TTTAATAAAGGAAGACTGTTCGG + Intergenic
1050776677 9:9271773-9271795 TTTAAAAAAAGAAGAAATTTAGG + Intronic
1050862974 9:10459691-10459713 CTTCTCAAAAGAAGACATTTAGG - Intronic
1050977581 9:11960997-11961019 TTTATCAGAAGAAGTCAGGTAGG + Intergenic
1050997494 9:12238740-12238762 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1051214082 9:14778206-14778228 TTTATGAAAGGAAAACTGATTGG - Intronic
1051270279 9:15348712-15348734 TTTATGTAAAGAAGAAATTGAGG + Intergenic
1051637720 9:19196174-19196196 TTTCTGCAAAGAAGACAGCTGGG - Intergenic
1051743990 9:20277441-20277463 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1052186365 9:25601020-25601042 TTTATGTCAGAAAGACAGTTAGG - Intergenic
1052206480 9:25847553-25847575 TTTGTGAAAAGAAAATATTTTGG + Intergenic
1052604466 9:30681430-30681452 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1052610380 9:30765231-30765253 TGTATGGGATGAAGACAGTTGGG - Intergenic
1052617347 9:30857660-30857682 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1053398088 9:37793133-37793155 TTTTTGCAATGAAGGCAGTTGGG - Intronic
1055169767 9:73241874-73241896 TTTATGAAAAGAATAAATTATGG + Intergenic
1056193854 9:84210351-84210373 CTTATGAAAAAAAGACAAGTGGG - Intergenic
1056394820 9:86172308-86172330 TTTCTGCAAAGAAGCCAGCTGGG + Intergenic
1056894971 9:90536950-90536972 TCTATGAATAGAAGACTCTTAGG + Intergenic
1057146179 9:92760821-92760843 TTTCTGAACAGAAGGCTGTTGGG - Intronic
1057269525 9:93642298-93642320 TTTCTGCAAAGAAGTCAGCTGGG + Intronic
1057730781 9:97606364-97606386 ATTATGAAGAGAAGAGATTTGGG - Intronic
1057918992 9:99081209-99081231 CTTCTGAAGAGATGACAGTTGGG + Intergenic
1058601649 9:106676890-106676912 CTTCTTAAAAGAAGAAAGTTAGG - Intergenic
1058614793 9:106814524-106814546 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1058615603 9:106824063-106824085 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1058662011 9:107275182-107275204 TGGATGGAAAGAAGCCAGTTAGG - Intergenic
1059468626 9:114486205-114486227 TTCTTAAAAAGAAGAAAGTTGGG - Intronic
1060116392 9:120944758-120944780 TTAATGAACAGACCACAGTTTGG + Intergenic
1061269797 9:129532721-129532743 TTTTTAAAAAGAACAAAGTTAGG + Intergenic
1061794105 9:133074230-133074252 TTTTTGAAAAAAATACAGATGGG - Intronic
1185487678 X:495385-495407 TTTAAGAAAAAAAAACAGTTGGG - Intergenic
1186259318 X:7759471-7759493 TCTATGTAAAGAACACAATTTGG + Intergenic
1186618459 X:11214370-11214392 TTGATAAAAAGAATGCAGTTGGG + Intronic
1187942590 X:24396393-24396415 TTTATGGAAAGAGGAAAGTGTGG + Intergenic
1188765875 X:34089748-34089770 TTTATAAAAAGAATCCAGTCTGG - Intergenic
1188954642 X:36419089-36419111 ATTATGAATAAAAGACAGCTAGG + Intergenic
1189020646 X:37334542-37334564 TCTAGGAAAAGAAGGTAGTTTGG + Intergenic
1189196061 X:39153931-39153953 CTTATTAACAGAAGACACTTTGG + Intergenic
1189339547 X:40194311-40194333 TTTCAGAAAAGAAGAAAGTTTGG - Intergenic
1189441664 X:41041820-41041842 TTTATCAAAAGAAGACACACGGG + Intergenic
1189685986 X:43564043-43564065 TTTTTGTAAAGAAGTCAGTTGGG - Intergenic
1189978800 X:46488932-46488954 TTCATGAAAAGAAGATCATTGGG + Intronic
1190424943 X:50326677-50326699 TCTATGAAAAGACGACATTCTGG - Intronic
1190684540 X:52859793-52859815 CTTCTCAAAAGAAGACACTTAGG + Intergenic
1190686955 X:52883341-52883363 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1190699027 X:52972451-52972473 CTTCTCAAAAGAAGACATTTAGG + Intronic
1190836232 X:54103054-54103076 TTTCTGCAAAGAAGAAAGCTGGG + Intronic
1191828919 X:65393986-65394008 CTTCTCAAAAGAAGACATTTAGG - Intronic
1191897630 X:66010356-66010378 TTTATGAAAGGTAGAAATTTTGG - Intergenic
1192091841 X:68167211-68167233 TTTCTCAAAAGAAGACAAATGGG + Intronic
1192391711 X:70735689-70735711 TTTCTGCAAAGAAGACAGCTGGG - Intronic
1192791453 X:74385799-74385821 TTTTTGAAAACAGGACATTTTGG - Intergenic
1193196780 X:78641079-78641101 TTTCTGCAAAGAAGACATCTGGG + Intergenic
1193381667 X:80823009-80823031 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1193547739 X:82850417-82850439 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1193642123 X:84022401-84022423 TTTATGAATAAAAGTCAGCTGGG + Intergenic
1194073128 X:89352010-89352032 TGTATAAAAGGAAGACAGTCTGG + Intergenic
1194162068 X:90466320-90466342 TTTAAGAAGAAAAGACATTTTGG + Intergenic
1194175444 X:90641098-90641120 CTTCTCAAAAGAAGACATTTGGG - Intergenic
1194246974 X:91526148-91526170 TTCATGAGAAGGAGACAGGTAGG - Intergenic
1194836043 X:98684200-98684222 TTTATCAAAAGAAGACATAAAGG - Intergenic
1194838395 X:98710164-98710186 TTGATAAAAATAAGACAGATAGG - Intergenic
1195128725 X:101834411-101834433 TTTCTGCAAAGAAGCCAGTTGGG + Intronic
1195177438 X:102324425-102324447 TTTCTGCAAAGAAGTCAGTTGGG - Intronic
1195181426 X:102362668-102362690 TTTCTGCAAAGAAGTCAGTTGGG + Intronic
1195579173 X:106482207-106482229 TTTAATAAAAGAAGACTGTTGGG + Intergenic
1196043889 X:111235563-111235585 TTTCTGCAAAGAAGCCAGCTAGG - Intergenic
1196888496 X:120270072-120270094 TCTCTGAAGAGAAGACAGTCAGG + Intronic
1197051690 X:122066733-122066755 CTTCTAAAAAGAAGACATTTAGG + Intergenic
1197120919 X:122891291-122891313 TTTTTAAAATGAAGACACTTGGG - Intergenic
1197458200 X:126704086-126704108 TTTACTAAAATAAGACAGATAGG + Intergenic
1197639191 X:128949487-128949509 TCTGTGAAAAGAATAAAGTTAGG + Intergenic
1197829094 X:130622357-130622379 TATATGAAAAGCATACATTTTGG + Intergenic
1197854057 X:130895933-130895955 TTTCTGAAAAGTACACATTTGGG + Intronic
1197915760 X:131532984-131533006 TTTTTATAAAGAAGAAAGTTGGG - Intergenic
1198013735 X:132587587-132587609 TTTGTGAAAAGAATACATTTTGG + Intergenic
1198834048 X:140782859-140782881 TTTATGTCAAAAAGACAGTTTGG - Exonic
1198958956 X:142163500-142163522 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1199177913 X:144813283-144813305 TTTATTAAAATAAGACAGAGAGG + Intergenic
1199481240 X:148300537-148300559 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1199483751 X:148326287-148326309 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1199564102 X:149196260-149196282 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1199668358 X:150120399-150120421 TTATTGAAAAGAAGCCAGTTGGG + Intergenic
1200298434 X:154946923-154946945 TTTCTCAAAAGAAGACATTCAGG + Intronic
1200508347 Y:4044065-4044087 TTTAAGAAGAAAAGACATTTTGG + Intergenic
1200565939 Y:4767436-4767458 TTCATGAGAAGGAGACAGGTAGG - Intergenic
1200727362 Y:6687750-6687772 TGTATAAAAGGAAGACAGTCTGG + Intergenic
1200728514 Y:6703525-6703547 TGTATAAAAGGAAGACAGTCTGG + Intergenic
1201603445 Y:15757966-15757988 TCTATGTAAAGAACACAGTTTGG - Intergenic
1201778260 Y:17690139-17690161 GTTCTCAAAAGAAGACATTTAGG - Intergenic
1201823296 Y:18215853-18215875 GTTCTCAAAAGAAGACATTTAGG + Intergenic
1201946032 Y:19511154-19511176 TTTTTGAAAAGAAGACCTATAGG + Intergenic
1201976709 Y:19857604-19857626 TTCATGAAAAGAAGACACCAAGG + Intergenic
1202064200 Y:20920696-20920718 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1202191137 Y:22246997-22247019 TTTAAGAAAGGAAGAAATTTAGG - Intergenic