ID: 978464558

View in Genome Browser
Species Human (GRCh38)
Location 4:108994467-108994489
Sequence CAAATGGGCAGAGCCCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978464551_978464558 30 Left 978464551 4:108994414-108994436 CCATTGCTGAGGCTTGAGTAGCT 0: 55
1: 1422
2: 1640
3: 1491
4: 1396
Right 978464558 4:108994467-108994489 CAAATGGGCAGAGCCCACTGCGG 0: 1
1: 0
2: 0
3: 25
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978464558 Original CRISPR CAAATGGGCAGAGCCCACTG CGG Intronic
900360172 1:2284555-2284577 CCACTGGGGTGAGCCCACTGGGG - Intronic
904748278 1:32724833-32724855 CAAATGGGCAGGGCACAGAGTGG + Intergenic
905943399 1:41882366-41882388 CAACTGAGCAGACCCTACTGTGG + Intronic
907548414 1:55283472-55283494 CCTATGGGCACAGCACACTGTGG + Intergenic
907797932 1:57736282-57736304 CAAAGAGGCAGAACCCAGTGAGG + Intronic
910023491 1:82621782-82621804 CTAATTGGCAGAGCCAACTCTGG - Intergenic
910603370 1:89055503-89055525 CATATGGGCTGAGCCTGCTGGGG + Intronic
910637346 1:89423611-89423633 CATATGGGCTGAGCCTGCTGGGG - Intergenic
910983207 1:92978816-92978838 CTAGTGAGCAGAACCCACTGTGG + Intergenic
911566061 1:99464829-99464851 CCAAGCAGCAGAGCCCACTGAGG + Intergenic
911745024 1:101432227-101432249 CAGATAAGCAGAGCTCACTGAGG - Intergenic
912047888 1:105483531-105483553 CAAATGTGCAAAGCCCTCAGGGG + Intergenic
913272996 1:117112332-117112354 CAGGTGGGCAGAGCGCACCGAGG - Exonic
913490128 1:119371550-119371572 AAAATGGGCACAGCCAAGTGTGG - Intronic
915163297 1:153934153-153934175 CCGAGGGGCACAGCCCACTGTGG - Exonic
915883868 1:159702339-159702361 CAAATGGGCAGACCCAAGTTCGG + Intergenic
916192469 1:162192616-162192638 CAAAGAGGCAGTGCCCACTGAGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
917573658 1:176296732-176296754 AAAGTGGGCGGAGCCCACCGTGG - Intergenic
917981606 1:180272936-180272958 CAAATGACCAGGGCCCTCTGCGG - Intronic
918757264 1:188354838-188354860 CAAATGGACAGAGACCTGTGTGG - Intergenic
920932804 1:210404673-210404695 CAAACAGGTAGAGCCCGCTGGGG + Exonic
922005617 1:221527868-221527890 CAAATGTGCAAAGTCAACTGAGG - Intergenic
923534152 1:234835695-234835717 CAAATGGGCAGTGCAGTCTGGGG - Intergenic
1062832711 10:616845-616867 CAAATGAGTAGAGGCCACGGCGG - Intronic
1063159990 10:3412192-3412214 CAACATGGCAGAGCCAACTGAGG + Intergenic
1064270392 10:13859974-13859996 TAAATGGGCCGAGCCCAGTGGGG + Intronic
1065321382 10:24513215-24513237 CAGGCAGGCAGAGCCCACTGAGG + Intronic
1066448046 10:35501940-35501962 CAAATGGGAAGAGTCAAGTGTGG - Intronic
1069066957 10:63951890-63951912 GAAATGGAGAGAGCCCTCTGGGG + Intergenic
1070584887 10:77756596-77756618 TAAATGGTCAGAGCCAAATGAGG - Intergenic
1072633642 10:97163932-97163954 CAACTGGGCAGAGCCCACACAGG + Intronic
1074097358 10:110325811-110325833 CAAATGTCCAGACCCCACTCCGG + Intergenic
1074506099 10:114072191-114072213 CAGTGGGGCAGAGCTCACTGCGG - Intergenic
1074600312 10:114907349-114907371 CAAATGGGACCAGTCCACTGTGG + Intergenic
1076684296 10:132190126-132190148 CGAATGCGCAGAGCACAGTGAGG - Intronic
1076941733 10:133614661-133614683 CAACTGGGCTAATCCCACTGAGG - Intergenic
1076942081 10:133616614-133616636 CAACTGGGCTAATCCCACTGAGG - Intergenic
1078560431 11:12366448-12366470 GAATTGGGTGGAGCCCACTGCGG + Intergenic
1078934456 11:15939331-15939353 CTGAAGGGCAGAGCCCACCGTGG - Intergenic
1081805351 11:45886935-45886957 CAGGTGGGCAGAGACCCCTGGGG + Intronic
1081813792 11:45927690-45927712 CCAATTGACAGAGGCCACTGAGG - Intronic
1085265483 11:75235630-75235652 CTAAAGGGCAGAGCCGACTGAGG - Intergenic
1086788650 11:91006294-91006316 CAGATGGGCAGTGCACACTGAGG + Intergenic
1086931146 11:92694624-92694646 CACATGGCCACAGCCCATTGTGG - Intronic
1087651729 11:100875686-100875708 CCACTGAGAAGAGCCCACTGTGG - Intronic
1090485277 11:127107209-127107231 TGAATGGGCACAGCCCTCTGTGG + Intergenic
1090744843 11:129697306-129697328 GAAATGTGCAGAGCTTACTGTGG + Intergenic
1091582761 12:1799076-1799098 GAACTGAGCAGAGCCCGCTGAGG + Intronic
1091928382 12:4374276-4374298 CACATAGGCAGACACCACTGTGG - Intronic
1091973639 12:4809057-4809079 GAAATGAGAAGAGCCGACTGCGG + Intronic
1092023605 12:5222746-5222768 CAAAAGGGGACAGCCAACTGAGG - Intergenic
1092040560 12:5380218-5380240 CAAATGCTCAGAGCCTCCTGCGG + Intergenic
1092937170 12:13374967-13374989 CAAATGGCCAGATTCCACAGAGG + Intronic
1096111263 12:49030664-49030686 TCAATGGGCAGAGCCAGCTGAGG - Exonic
1096541392 12:52309272-52309294 CAGATGGGCAGCACCTACTGTGG - Intergenic
1096673564 12:53214419-53214441 GGAATGGGCAGAGCCCAGTGAGG - Intronic
1096747048 12:53735833-53735855 CAGATGGGGAGAGCACACTCTGG + Intergenic
1103750012 12:123151704-123151726 CCAATGGGAAGAGCCCCCGGTGG + Intergenic
1107473444 13:40712616-40712638 AAACTGGGTGGAGCCCACTGCGG - Intergenic
1107821007 13:44285703-44285725 CAGATGGGGAGAGAGCACTGGGG - Intergenic
1111050403 13:82876293-82876315 CAAATAGGCAGAGGCCACAGAGG + Intergenic
1112108660 13:96270140-96270162 CAAAGAGACAGAGCACACTGTGG - Intronic
1113343396 13:109448216-109448238 CAAATGGTAAGATCACACTGAGG + Intergenic
1113777203 13:112954594-112954616 CCAGTGGGAAGAGCCCACTGAGG - Intronic
1113940029 13:114014233-114014255 CAGATGAGCACAGACCACTGTGG - Intronic
1114032823 14:18590715-18590737 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1114077611 14:19169762-19169784 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1114084553 14:19229821-19229843 CAAATGGCCAGAGGCATCTGGGG + Intergenic
1117962763 14:61179179-61179201 CAAAAGGGCAGAGTCCATTTCGG - Intergenic
1118841986 14:69520282-69520304 CCAGGAGGCAGAGCCCACTGAGG + Intronic
1119207698 14:72806966-72806988 CAAATGGGCAGACTCTCCTGGGG - Intronic
1123475822 15:20592186-20592208 CCCCTGGGCAGAGCCCTCTGAGG + Intergenic
1123642189 15:22408177-22408199 CCCCTGGGCAGAGCCCTCTGAGG - Intergenic
1124615835 15:31241417-31241439 CTAATGGGCAGAGCATTCTGTGG - Intergenic
1125523585 15:40361728-40361750 CAGATGGGCATTGCCCACAGAGG - Intronic
1125606453 15:40942197-40942219 AAAATGGGGAGAACCCAGTGCGG + Intergenic
1126950114 15:53871447-53871469 TAAATGAGCAGAGCCTGCTGTGG - Intergenic
1129888512 15:79055637-79055659 GCAAAGGGCAGAGCCCCCTGTGG - Intronic
1129920800 15:79317546-79317568 CAAATCCGCAGAGAACACTGTGG - Intronic
1131885406 15:96907063-96907085 CAAAGAGGCAGTGCCCTCTGTGG + Intergenic
1132772530 16:1572165-1572187 CAGGTGGGCAGAGGCCACAGGGG + Intronic
1133978966 16:10619541-10619563 CAGGTGGGCAGTGCCCACGGTGG + Intergenic
1134643416 16:15847553-15847575 CAATTAGGAAGAGCCCACTTAGG - Intronic
1136071605 16:27790998-27791020 CAGAGGGGCAGAGCCCTTTGGGG - Exonic
1136241028 16:28944119-28944141 CAAAGTGGCAGAGCCCACAAGGG - Intergenic
1137391738 16:48087020-48087042 CAATGGAGCAGAGACCACTGAGG + Intronic
1138124473 16:54427339-54427361 CAACTGGGAAGAGCCCATGGAGG + Intergenic
1139505634 16:67396805-67396827 CAGAGGGGCAAAGCCCACTGGGG + Intronic
1140860112 16:79010792-79010814 CCTAAGGGCAGAGCACACTGGGG + Intronic
1144540014 17:16131980-16132002 CAATTGGGCAGAGCACTCTGGGG + Intronic
1144727431 17:17508830-17508852 CACATGGGCAGAGGCTATTGGGG + Intronic
1145940352 17:28740387-28740409 CGAATGAGGAGGGCCCACTGAGG - Intronic
1146901343 17:36591691-36591713 CCAAAGGGCAGCGCTCACTGGGG + Intergenic
1148128990 17:45251363-45251385 AAAATGGGCAAAGCCAAGTGTGG + Intergenic
1148864055 17:50619426-50619448 AAAATGAGCAGAGCCCACGGCGG - Intronic
1152501086 17:80709481-80709503 CAAGTGAGCAAAGCGCACTGCGG - Intronic
1153690821 18:7591930-7591952 CACATAGGGAGAGCCCCCTGAGG - Intronic
1154193787 18:12251701-12251723 AGAAAGAGCAGAGCCCACTGTGG + Intergenic
1154355098 18:13619049-13619071 CAGCTGGGCAGAGCCCACCGGGG + Intronic
1155869692 18:31010788-31010810 CCAATGGACAGAAGCCACTGAGG + Intronic
1156337736 18:36186006-36186028 TCAGTGGGCAGAGGCCACTGAGG + Intergenic
1156399441 18:36727569-36727591 CAAATGTGCAGAATCCTCTGTGG + Intronic
1158000798 18:52616515-52616537 CAAATGGGCCAAGCGCAGTGAGG - Intronic
1158133881 18:54184318-54184340 CACATGCGCAGAGCACAATGGGG - Intronic
1159635626 18:70801313-70801335 GGAATGGGGAGAGGCCACTGTGG + Intergenic
1161044200 19:2126274-2126296 CAGCTTGGCAGAGACCACTGGGG + Intronic
1161951628 19:7470910-7470932 CCACGGGGCAGGGCCCACTGAGG + Exonic
1163229736 19:15993172-15993194 CAGATGGGCACTGCCCCCTGAGG + Intergenic
1163294579 19:16404120-16404142 CAGATGGGCTCATCCCACTGTGG + Intronic
1163987491 19:20967444-20967466 CAGATGGACACAGACCACTGTGG + Intergenic
1164108658 19:22134183-22134205 CACATAGACCGAGCCCACTGAGG + Intergenic
1164416050 19:28047242-28047264 CAAATTGGCTGACCCCAGTGAGG + Intergenic
1164417895 19:28061439-28061461 CAAATTGGCTGATCCCAGTGAGG + Intergenic
1165320290 19:35080722-35080744 CAGAGGGGCAGTGCCCACGGTGG - Intergenic
1167158347 19:47752634-47752656 CCAAGAGGCAGAGCCCACTGAGG - Intronic
1168447307 19:56431371-56431393 CAAATGGACATAGCACACAGTGG + Intronic
925130636 2:1491907-1491929 CAGGGCGGCAGAGCCCACTGTGG + Intronic
925192800 2:1899043-1899065 AACATGGGCAGAGCCCATTTGGG + Intronic
927330314 2:21854974-21854996 CAAATGAGCAGAGGCAACTCAGG - Intergenic
927345183 2:22030105-22030127 GTAATGGGCAGAGTCCAGTGAGG + Intergenic
927889346 2:26738700-26738722 CAGATGGGCAGACCCCTCTCCGG + Intergenic
928600564 2:32900237-32900259 CCAATGGGCAGAGGGGACTGGGG - Intergenic
928634232 2:33226795-33226817 AAAATGGCCAGAACCAACTGAGG - Intronic
931960116 2:67473104-67473126 GAAAGGGGCAGAGCCAACTAGGG + Intergenic
935806021 2:106748416-106748438 CAAACTGGCAGAGCCAACTAAGG - Intergenic
936074993 2:109396137-109396159 CAAGTGGGCAGAGAACACTGGGG + Intronic
937206335 2:120239261-120239283 CAAGTGAGCAGAGCACACAGGGG + Intergenic
938492035 2:131766289-131766311 CAAATGGCCAGAGGCATCTGGGG - Intronic
938495532 2:131796054-131796076 CAAATGGCCAGAGGCATCTGGGG + Intronic
938590846 2:132734861-132734883 GAACTGAGCAGAGCCCACTTTGG - Intronic
941268445 2:163394042-163394064 CATGTGGGCAGACTCCACTGCGG + Intergenic
942848036 2:180449369-180449391 CAGATGGTCAGTGCCCACAGTGG + Intergenic
946050647 2:216859642-216859664 CACCAGGGCAGAGCCCGCTGGGG + Exonic
946496487 2:220200816-220200838 CCAATGGGCAGAGCTTCCTGTGG + Intergenic
1170525585 20:17233014-17233036 CAAATGGATAGAGAACACTGTGG - Intronic
1170591835 20:17777285-17777307 CAGATGGACACAGGCCACTGAGG + Intergenic
1171444576 20:25194811-25194833 CAAGTGGGCAGCCCCCACCGTGG + Intergenic
1172131019 20:32655501-32655523 AAAATGGGCTGAGCCAAGTGTGG + Intergenic
1172235113 20:33366874-33366896 CAACTGGGTACAGCCCACAGAGG + Exonic
1173315164 20:41936618-41936640 CAGCTGAGCAGAGCCCAGTGGGG + Intergenic
1173595891 20:44258239-44258261 CAGCTTGGCAGAGCCCAGTGAGG + Intronic
1175584599 20:60127932-60127954 CATGTTGGCTGAGCCCACTGAGG - Intergenic
1176709330 21:10136098-10136120 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1178393286 21:32216883-32216905 CAAATGAGCAGAGCCTTCAGGGG + Intergenic
1180293417 22:10863380-10863402 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180456938 22:15517771-15517793 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180496223 22:15892796-15892818 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180916075 22:19488294-19488316 AATTTGGGCAGAGCCCAGTGAGG + Intronic
1183870719 22:40739971-40739993 CAAATGGGCAGAACCAAATGAGG - Intergenic
1185155846 22:49193004-49193026 CACATAGGCAGAGCACGCTGTGG + Intergenic
949537152 3:5004931-5004953 CAAAGGGGCAGAGCCCAGGCTGG + Intergenic
949557103 3:5164058-5164080 CATATGTGCAGGGCCGACTGCGG - Intronic
952390304 3:32874058-32874080 CAATTGGGCAGATTCCAGTGTGG + Intronic
954763604 3:52895539-52895561 CACATGTGCAAATCCCACTGTGG - Intronic
954983867 3:54771860-54771882 CACATGGACAGAGACCACTGGGG - Intronic
959947115 3:112136948-112136970 AAAATGTGCTGAGGCCACTGAGG - Intergenic
960116323 3:113896656-113896678 CAAATGAAGAAAGCCCACTGTGG - Intronic
961519658 3:127459580-127459602 CAAATGGGGAGAGCCTGCAGAGG + Intergenic
961661016 3:128468822-128468844 CCAAGGGGCAGATCCCACAGTGG + Intergenic
966668747 3:182503089-182503111 CAAATTGGCTGTGCTCACTGTGG - Intergenic
967870473 3:194225120-194225142 CAGCAGGGCAGAGCCCACGGGGG + Intergenic
968501342 4:951606-951628 GGAATGGACAGAGCCCACTCCGG - Intronic
968885934 4:3332129-3332151 CAAAGGGGCAGAGACCAGTGTGG + Intronic
970849478 4:20583977-20583999 CATATGTTCAGAGCCCCCTGTGG - Intronic
971868201 4:32200699-32200721 GAAATGAACAGAGCCCAGTGTGG + Intergenic
974974951 4:68880380-68880402 CAAATAGAAAGAGCACACTGTGG + Intergenic
975072290 4:70157118-70157140 CATATTGCCAGAGCCCCCTGAGG - Intronic
978119454 4:105060913-105060935 CGTATGGGCAGACCTCACTGTGG - Intergenic
978278575 4:106981658-106981680 CAAATAGGCAAAGTCCACAGAGG - Intronic
978464558 4:108994467-108994489 CAAATGGGCAGAGCCCACTGCGG + Intronic
979705383 4:123713970-123713992 GAACTGGGCAGAACCCACTGTGG + Intergenic
981617031 4:146653078-146653100 GAACTGGGCAGAGACAACTGAGG - Intergenic
983500415 4:168493414-168493436 CAAATTGGCAGTATCCACTGTGG - Intronic
983957049 4:173710150-173710172 CAAATGGGCAGACCCCAAATGGG - Intergenic
984589465 4:181601025-181601047 CCAGTGGGCAGAGCCCAGAGTGG + Intergenic
984706553 4:182851315-182851337 CAGATGAGCAGACCCCACTTGGG - Intergenic
985032369 4:185802436-185802458 CAAGTGGTCAGACCCAACTGTGG - Intronic
985221791 4:187713951-187713973 CAAATGGGAAGAGAGGACTGAGG + Intergenic
986267513 5:6203032-6203054 CCAAGGGGCAGTTCCCACTGTGG + Intergenic
987144013 5:14973737-14973759 GATTTGGTCAGAGCCCACTGGGG - Intergenic
989238433 5:39176075-39176097 CAAATATGAAGAGGCCACTGTGG - Intronic
990019612 5:51108849-51108871 CAAATGGGCATACCTCAGTGCGG + Intergenic
991652090 5:68865659-68865681 GAACTGGGCAGAGCCCACCACGG + Intergenic
991930106 5:71745928-71745950 CAGATGGGCAAAGCCCACCAAGG - Intergenic
996639981 5:125740499-125740521 CAACTGGGTGGAGCCCACCGCGG - Intergenic
998213545 5:140219901-140219923 CAAATGGGCAGAGATCACCAAGG - Intronic
1001133167 5:169080997-169081019 CAAATGCACAGAGAGCACTGTGG + Intronic
1001346366 5:170903232-170903254 AAAATGGGCGGAGCCCACCACGG - Intronic
1001985617 5:176072727-176072749 CACATGGGCTGGGCCCAGTGAGG - Intronic
1002470750 5:179434166-179434188 AAAATGGGAGGATCCCACTGTGG - Intergenic
1003946086 6:11077216-11077238 CAGATGGGCACAACCCAGTGGGG - Intergenic
1006645978 6:35514330-35514352 TATATGGTCAGAGCCAACTGAGG - Intergenic
1006778714 6:36617092-36617114 CAAGTGGCCAGAGCCCTCTCAGG - Intergenic
1007480031 6:42143555-42143577 AAAGTGGGTAGAGCCCACTTAGG + Intergenic
1007582033 6:42965514-42965536 AAATTGGGCAGGGTCCACTGAGG - Intronic
1009709597 6:67300378-67300400 CAACTGGGTGGAGTCCACTGTGG - Intergenic
1010687214 6:78867292-78867314 AGAAAGGGCAGAGCTCACTGAGG + Intergenic
1011336950 6:86272160-86272182 AAACTGGGCAGAGCCCACCATGG - Intergenic
1011404118 6:86999443-86999465 AAAATGGGGAGACCTCACTGAGG + Intronic
1013067405 6:106697173-106697195 CAAATGTTCACAGCCCACTGGGG + Intergenic
1013935012 6:115583540-115583562 CATATGGCCAGAGCCCAGGGAGG - Intergenic
1017508246 6:155088619-155088641 TAACTGGGCTGAGCTCACTGAGG + Intronic
1017884144 6:158585166-158585188 CAAATGTGCTGAGGCCAATGTGG + Intronic
1019222271 6:170482701-170482723 AAAATGGGCAGAGCACAGGGGGG + Intergenic
1021571984 7:22075257-22075279 GAAATGGGCAGAAACCACAGGGG - Intergenic
1022472531 7:30690642-30690664 GAAATGGACTGAGCCCAATGTGG - Intronic
1022572178 7:31465569-31465591 CAAATGACCAGAGCCCATGGAGG + Intergenic
1024533332 7:50410562-50410584 GCAAGGGGCAGTGCCCACTGAGG - Intergenic
1025783907 7:64626696-64626718 CATATGGACAGTGCCAACTGGGG + Intergenic
1026892402 7:73989982-73990004 CACATGAGCAGAGGCCACAGGGG + Intergenic
1026933860 7:74240592-74240614 CATGTGGGCAGTGCCAACTGAGG - Intronic
1032690363 7:134280218-134280240 CAAATTGGTAGAGCCCACTTGGG - Intergenic
1034097696 7:148425100-148425122 GAACTGGGTGGAGCCCACTGTGG + Intergenic
1035240451 7:157525814-157525836 AAAGTGGGCAGTGCGCACTGTGG + Intergenic
1035844915 8:2852812-2852834 CAACTGGACAGAGCCCCCAGAGG + Intergenic
1036607624 8:10321539-10321561 CATATGGGCAGAGAGCACTGGGG - Intronic
1038443235 8:27586102-27586124 CCACAGGGCAGAGCCCCCTGGGG - Intergenic
1042376448 8:68057690-68057712 CAAATGGGCATATCCCAGTGAGG - Intronic
1045928347 8:107596919-107596941 AAACTGGGCAGAGCCCACAATGG - Intergenic
1049167636 8:141136605-141136627 CAAATGGCCGGTGCCAACTGCGG + Exonic
1053153810 9:35759976-35759998 CAAATGGGCTGCGTCCACTGAGG + Intergenic
1053646299 9:40121634-40121656 CAAATGGCCAGAGACATCTGGGG - Intergenic
1053759415 9:41341917-41341939 CAAATGGCCAGAGACATCTGGGG + Intergenic
1054538269 9:66254339-66254361 CAAATGGCCAGAGACATCTGGGG + Intergenic
1055852369 9:80647528-80647550 CAAATGGGAAGAGGAAACTGAGG - Intergenic
1056581446 9:87890048-87890070 CCCCTGGGCAGAGCCCTCTGGGG - Intergenic
1057172273 9:92969976-92969998 CAGATGAGCCGTGCCCACTGTGG - Intronic
1057900114 9:98942233-98942255 CCAATGGACAGAGAGCACTGTGG + Intergenic
1058766390 9:108186518-108186540 GAGATGGGCAGAGACCACTTAGG + Intergenic
1058959184 9:109976896-109976918 AAGATGAGCAGTGCCCACTGCGG - Intronic
1059451343 9:114373015-114373037 CAGGTGGGCGGAGGCCACTGTGG - Intronic
1059452562 9:114379498-114379520 AAAGTGGGCACTGCCCACTGAGG - Intronic
1061199857 9:129131541-129131563 CAGATGGGTAGGGACCACTGTGG - Exonic
1061209382 9:129182006-129182028 CAACAGGGCAAATCCCACTGTGG - Intergenic
1062009205 9:134258235-134258257 GAACGAGGCAGAGCCCACTGGGG + Intergenic
1062012308 9:134273722-134273744 CAAAGGGGCAGAGCACAGAGTGG - Intergenic
1062219563 9:135407575-135407597 CAAATGAGGAGACCCCACTGTGG - Intergenic
1062621758 9:137426012-137426034 CCAAGGCGCAGAGCCCACTGAGG - Intronic
1186443654 X:9607444-9607466 AAACAAGGCAGAGCCCACTGGGG + Intronic
1187346207 X:18466855-18466877 CAAATGCGGAGAGCTCCCTGGGG - Intronic
1194893302 X:99406905-99406927 CCACTAGGCAGTGCCCACTGGGG - Intergenic
1195369402 X:104158252-104158274 CAGAAGGGCAGAACCCACTAAGG + Intergenic
1195792402 X:108602465-108602487 CAAATGGCAAGAGCACACAGTGG + Intronic
1198836039 X:140805798-140805820 CACATGGGCAGAGCTTTCTGAGG - Intergenic
1201707159 Y:16949985-16950007 AAATTGGGCACAGCCCACAGAGG + Intergenic