ID: 978465865

View in Genome Browser
Species Human (GRCh38)
Location 4:109008267-109008289
Sequence AAGAGGGACAAGGAAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 1, 2: 7, 3: 54, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978465865_978465870 -8 Left 978465865 4:109008267-109008289 CCATCAACTTCCTTGTCCCTCTT 0: 1
1: 1
2: 7
3: 54
4: 516
Right 978465870 4:109008282-109008304 TCCCTCTTTGGGATGATTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 153
978465865_978465869 -9 Left 978465865 4:109008267-109008289 CCATCAACTTCCTTGTCCCTCTT 0: 1
1: 1
2: 7
3: 54
4: 516
Right 978465869 4:109008281-109008303 GTCCCTCTTTGGGATGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
978465865_978465873 29 Left 978465865 4:109008267-109008289 CCATCAACTTCCTTGTCCCTCTT 0: 1
1: 1
2: 7
3: 54
4: 516
Right 978465873 4:109008319-109008341 GTCTCTCAAGATTCCTCAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978465865 Original CRISPR AAGAGGGACAAGGAAGTTGA TGG (reversed) Intronic
900972431 1:5998955-5998977 AAGGAGGAAAAGGAAGGTGAGGG + Intronic
901212994 1:7536935-7536957 CAGAGGGACGAGGAAGATGTGGG - Intronic
901753325 1:11425546-11425568 AAAAGGGAAAATGAAGTGGAAGG + Intergenic
902157964 1:14505041-14505063 AAAAGGGATGAGGAAGTAGAAGG - Intergenic
902764757 1:18606861-18606883 AAGAGGAACAAGGATGATGGTGG - Intergenic
902858110 1:19224002-19224024 TAGTGGGTCAAGTAAGTTGAGGG - Intronic
903220633 1:21867678-21867700 AAGTGAGACAGGGAGGTTGAGGG - Intronic
903322660 1:22552192-22552214 CAGAGGGACTGGGAAGTGGAGGG + Intergenic
904337033 1:29804577-29804599 AAAAGAGACAAGGAAGGTGCTGG - Intergenic
904848835 1:33441552-33441574 AAGAGGGAGGAGGAAGGAGAAGG - Intergenic
905415974 1:37804450-37804472 AAGAGGGAGAAGGAAGAGCATGG + Intronic
905883700 1:41480501-41480523 TAGAGGCACAGTGAAGTTGAGGG + Intronic
906918766 1:50040822-50040844 AAGAGGGAAATGGGAGTGGAGGG + Intergenic
907061613 1:51431872-51431894 AATAGGGATAATAAAGTTGATGG + Intronic
907334785 1:53692983-53693005 AAGATGGACATGGATGTAGAGGG - Intronic
907366361 1:53963953-53963975 AAGGGGGACAATGAAGATGGGGG - Intronic
908517120 1:64904388-64904410 AAGAGAGAGAAGGAAAATGAGGG + Intronic
908716130 1:67071230-67071252 AAGAGGGACAAAAAAGTTATAGG - Intergenic
909022163 1:70444316-70444338 GGGAGGGACAGGGAAGTTGAAGG + Intergenic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
910067854 1:83174821-83174843 AGGAGAGACAAGGAAATTGCTGG + Intergenic
911642103 1:100300468-100300490 AAGGGGGACAATGAAGAGGAGGG + Intergenic
912338322 1:108884616-108884638 TAGAGGGAAAAGGAAGGAGATGG + Intronic
912437930 1:109674969-109674991 AAGAGGGACAATGAAGTCTTGGG - Exonic
912440441 1:109693428-109693450 AAGAGGGACAATGAAGTCTTGGG - Exonic
913118384 1:115717439-115717461 AAGAGGATCATGGAAGGTGAGGG - Intronic
913319180 1:117576593-117576615 AAGAGGGCCAAGGAGGCAGATGG - Intergenic
914683697 1:149959392-149959414 AAAAGGGACCAGGAACTTGTAGG - Intronic
915553313 1:156647432-156647454 AGGAGTGACAAGGAGGGTGAGGG + Intronic
915736723 1:158089905-158089927 AAACGGGACAGGGAAGTTGAAGG - Intronic
915800211 1:158783309-158783331 AAGAGGGACCAGTATGCTGAGGG - Intergenic
916570779 1:166025453-166025475 GAGAGGGACAAAGGAGCTGAGGG - Intergenic
916828063 1:168462724-168462746 AGGATGGAAAAGGAAGATGAAGG - Intergenic
917726756 1:177835218-177835240 AAGAGGGACCATGAAATTGTAGG + Intergenic
918106209 1:181417440-181417462 CAGAGGGACAACAAAGTTGAGGG - Intronic
918195011 1:182213106-182213128 AACAGGGACAAGCAAGTTTGAGG - Intergenic
918268830 1:182874916-182874938 AAGAAGGATAAGGATGATGATGG + Exonic
918374486 1:183895436-183895458 GAGAGGGAGAAGGAGATTGATGG + Intronic
918625758 1:186654308-186654330 TAGAGGGACAAGGGACTTGAAGG + Intergenic
918716261 1:187790551-187790573 AAGAGGGAAAAGGGAGTAAAGGG + Intergenic
920067249 1:203277560-203277582 CAGAGGGACAAGGAAACAGAGGG - Intergenic
920179605 1:204124372-204124394 CAGAGGCTCAAGGAAGTTGCTGG + Intronic
920802042 1:209198411-209198433 AAGAGAGAGAAAGAAGTAGATGG - Intergenic
921302613 1:213765184-213765206 AAGAAGGCCAAGGAAGTTTATGG - Intergenic
921451731 1:215316402-215316424 AAAAGAGAAAAGGAAGGTGAAGG + Intergenic
922221982 1:223615605-223615627 AGGTGGCACAAGGAAGATGAGGG - Intronic
922429714 1:225538840-225538862 AAGAGGCAACTGGAAGTTGAGGG + Intronic
922722676 1:227906609-227906631 AGGAGGGAGAAGGGAGTAGAAGG - Intergenic
923120066 1:230981612-230981634 AAGAGGTACAAGGATGATGTAGG - Intronic
923263784 1:232293004-232293026 AAGAGCTACAAGGAAGGTAAAGG - Intergenic
924239110 1:242024409-242024431 ATGAGGGAGAAGGGAGTTAAAGG - Intergenic
924307738 1:242708871-242708893 AAGAGGATCAATGAAGTTAATGG + Intergenic
924370667 1:243346716-243346738 AAGAGATACAAAGGAGTTGATGG - Intronic
1062891146 10:1061311-1061333 AAGAGGGACAAGGAAGTGGCAGG - Intronic
1063374309 10:5544878-5544900 AGGAGGGACAAAGAAGGTGAAGG + Intergenic
1063850077 10:10177870-10177892 AAGAAGGAGAAGGAAGGAGAAGG - Intergenic
1064011601 10:11740944-11740966 AAGAGGGACATGCAGGTGGACGG - Intergenic
1064588443 10:16863817-16863839 GAGTGGCAGAAGGAAGTTGAAGG - Intronic
1065042180 10:21708452-21708474 CTGAGGAGCAAGGAAGTTGAAGG + Intronic
1065417154 10:25501079-25501101 AAGAGGCACAGGGAAGATCAGGG + Intronic
1066172556 10:32866646-32866668 AAAAGGGAGAAGGAAGCAGAGGG + Intronic
1066252821 10:33650942-33650964 AAGAGGAACATGAAACTTGAAGG - Intergenic
1066285258 10:33959679-33959701 AAGGTGGCAAAGGAAGTTGATGG - Intergenic
1066363980 10:34758533-34758555 AAGAGGAAGAAGGAAATTGTGGG - Intronic
1067534286 10:47097097-47097119 GAGAGGCACAAAGAAGTTCAGGG + Intergenic
1067942794 10:50670153-50670175 AGGAGCAACAAGGAAGTTGTGGG - Intergenic
1069836707 10:71313757-71313779 ATGAGGGACATGGGAGTTCAGGG + Intergenic
1070872487 10:79768842-79768864 AAGAGGGAAGAGGAAGATCAGGG + Intergenic
1070896604 10:79988048-79988070 AAGTGGGAGAATGAAGTTAAAGG + Intergenic
1071639409 10:87290994-87291016 AAGAGGGAAGAGGAAGATCAGGG + Intergenic
1071655829 10:87446955-87446977 AAGAGGGAAGAGGAAGATCAGGG - Intergenic
1072165871 10:92812677-92812699 GAGGTGGGCAAGGAAGTTGAAGG - Intergenic
1073039912 10:100596592-100596614 AAGAGAGAAAAGAAAGATGATGG - Intergenic
1073068380 10:100778019-100778041 AAGATGAACAAAGAAGTAGAGGG - Intronic
1073374414 10:103020713-103020735 GAGAGGGGAAAGGGAGTTGAGGG + Intronic
1073778724 10:106813987-106814009 AATAGATAAAAGGAAGTTGATGG - Intronic
1075077370 10:119360146-119360168 GAGGGGGTGAAGGAAGTTGAGGG + Intronic
1075274651 10:121082189-121082211 AAGATGGTCAAGGACGTTAAAGG + Intergenic
1076652030 10:131996623-131996645 GAGAGGGACAAGGCAGCTGAGGG - Intergenic
1076895432 10:133309109-133309131 AAGAGGGAAAAAGTAGTTGTAGG + Exonic
1077333768 11:1994489-1994511 AGGAGGGAGGAAGAAGTTGAGGG - Intergenic
1078118027 11:8474972-8474994 AAAAAGGATAAGGTAGTTGATGG + Exonic
1079079023 11:17401214-17401236 TCGAGGGACCTGGAAGTTGAAGG + Intronic
1079815892 11:25057351-25057373 AAAAGGAACAAGGAATCTGAGGG - Intronic
1080384452 11:31802906-31802928 AAGAAGGAAGAGGAAGATGAGGG + Intronic
1080864690 11:36182972-36182994 AAGAAGCACAAGGAATTTAAAGG + Intronic
1080935349 11:36857423-36857445 AAGAGCCACCAGTAAGTTGAGGG - Intergenic
1081391923 11:42539597-42539619 AAGTGGGACAGGGAAGGAGAAGG + Intergenic
1082294270 11:50418956-50418978 AAGAAGGATAAGGATGATGATGG + Intergenic
1083953877 11:65971711-65971733 AGGAGGGACAAGGCAGTTAAGGG + Intronic
1083958710 11:66002181-66002203 AAGACGGACAAGGGAGGGGACGG - Exonic
1085746703 11:79121321-79121343 AAGAGAGACCAGAAAGTTCAAGG + Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1085837199 11:79969757-79969779 AAAAGGGACAAGGAAGAAAAGGG + Intergenic
1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG + Intergenic
1086357308 11:86016536-86016558 AAGAGGTGCAAGAAAGTTAAAGG - Intronic
1086858988 11:91902099-91902121 AAGAGGGAAAAGGAAGTAGCTGG + Intergenic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1087150788 11:94857719-94857741 ATGAGGCACAGGGAAGTTAAAGG + Intronic
1089181500 11:116586409-116586431 AAGAGGGCCATAGAAGTTCATGG + Intergenic
1089429945 11:118414726-118414748 GTGAGAGGCAAGGAAGTTGAAGG - Intronic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089604895 11:119636091-119636113 TGGAGGGAGAAGGAAGATGATGG - Intronic
1090072233 11:123554008-123554030 AAGAGGGTCAAGGAAACAGAGGG - Intronic
1090925093 11:131242640-131242662 AAGAAGGACAAGGAAGATAATGG - Intergenic
1092602097 12:10078526-10078548 AAGAGGGATAAGGAATTCCAGGG - Intronic
1092881591 12:12891470-12891492 CAGAGGGACAAGGAGGGGGAGGG - Exonic
1093668226 12:21839901-21839923 AAGTGGGAGAAGGAATATGAAGG + Intronic
1093692024 12:22119659-22119681 ATAAGGGGCAAGGAAGTTGAAGG - Intronic
1094303219 12:28989481-28989503 AACAGGGACAAGTAAGAAGAAGG - Intergenic
1094474270 12:30829218-30829240 ACCAGGGACCAGCAAGTTGATGG - Intergenic
1095526808 12:43135857-43135879 AAGAGGTAAATGGAAGTTTAGGG + Intergenic
1095895747 12:47278846-47278868 AAGAGGCACAAGGATGATAATGG + Intergenic
1096265134 12:50116637-50116659 ATAAGTGACAGGGAAGTTGAAGG + Intronic
1096423293 12:51478923-51478945 ATGAGGCACAGGGAAGATGAGGG - Intronic
1097099305 12:56575528-56575550 AAGGGGGACTAGGAAGTGGCTGG - Intronic
1097101773 12:56594794-56594816 AACAAGGACAAGGAAGTTTGGGG - Exonic
1097463067 12:59888024-59888046 AAGAGAGTCAAAGAATTTGATGG + Intergenic
1097987693 12:65801734-65801756 AAGTGGGATAAGGAAGCTGGAGG + Intergenic
1099009703 12:77277238-77277260 AAGAGGGAAAAGGAAGACCAAGG - Intergenic
1102627163 12:114244462-114244484 AAGAGGAAAAGGGAAGTTGTAGG - Intergenic
1102637249 12:114335290-114335312 GAGAGGAAGAAGGAAATTGAGGG - Intergenic
1102845905 12:116182130-116182152 GAGAGGGTCAAGGAAGGTGGGGG - Intronic
1103466497 12:121145938-121145960 AGGAGAGAAACGGAAGTTGATGG + Intronic
1103620820 12:122186163-122186185 AAGAGGGGAGAGGAAGCTGAGGG - Intronic
1103786494 12:123436697-123436719 AAGAGGAACGGGGAAGTTCAGGG + Exonic
1103870017 12:124084726-124084748 GAGAAGGGGAAGGAAGTTGAAGG + Intronic
1104454323 12:128898163-128898185 AAGAAGGAAAAGGAAGAAGAAGG - Intronic
1104628548 12:130379904-130379926 AAGTGGGATGAGGGAGTTGAAGG - Intergenic
1104628572 12:130380036-130380058 AAGTGGGATGAGGGAGTTGAAGG - Intergenic
1104628588 12:130380124-130380146 AAGTGGGATGAGGGAGTTGAAGG - Intergenic
1105073564 12:133253658-133253680 AAGAAGGACCAGGAACTTGAAGG - Intergenic
1105617605 13:22033688-22033710 AAGGGGCACAAGGAAAATGAAGG - Intergenic
1106320079 13:28629623-28629645 AAGAGGGACAGGGAAGTTTCTGG - Intergenic
1106720487 13:32430127-32430149 CAGAGGGAAATGGAAGTGGACGG - Intergenic
1107128139 13:36866522-36866544 AAGAATGACAAGGATGTTCAAGG - Intronic
1107350370 13:39507969-39507991 AAGAGGGAAAAGAAAGGGGAGGG - Intronic
1107399171 13:40052046-40052068 AAGATGGACAAGGAAGATTAGGG + Intergenic
1107539376 13:41372225-41372247 AAGAGGTATAAGGAACTTAACGG - Exonic
1108157203 13:47597555-47597577 AAGATGCACAGGAAAGTTGAAGG + Intergenic
1110311399 13:74053803-74053825 AAGAGGGAGAATGAGGTGGAGGG + Intronic
1110569209 13:76986623-76986645 AAGAAGGACAAGGATGATGATGG + Intergenic
1110601744 13:77382736-77382758 AAGAGGGAAAAGGAGCATGAAGG - Intergenic
1110849936 13:80233358-80233380 GACAGGAACAAGGAAGGTGATGG - Intergenic
1113158551 13:107353056-107353078 AGGAGGCAGAAGGAAGGTGAGGG - Intronic
1113291739 13:108914491-108914513 AAGAGAGAGAATGAATTTGAAGG - Intronic
1113510959 13:110854584-110854606 AAGAGGCACAAGGGAATTGGGGG - Intergenic
1114048985 14:18903918-18903940 AAGAGAGACAAGAAAGTTGGGGG + Intergenic
1114113578 14:19498015-19498037 CAGAGAGACAAGAAAGTTGGGGG - Intergenic
1114115278 14:19615765-19615787 AAGAGAGACAAGAAAGTGGGGGG - Intergenic
1114621481 14:24098882-24098904 AATAGGGGCATGGAAGCTGATGG + Intronic
1114669523 14:24401414-24401436 AAGGAGGACAGGGAAGGTGAGGG + Intronic
1114961904 14:27902219-27902241 AAGAGCCAAAAGGAAGGTGAGGG - Intergenic
1115251390 14:31352167-31352189 AAGAGGGAAAATGAAGTATAGGG - Intronic
1115438858 14:33408737-33408759 ACCAGGAACAAAGAAGTTGAGGG + Intronic
1116024576 14:39499387-39499409 AAGAGAGAAAAGAAAGTTAATGG + Intergenic
1116315856 14:43391240-43391262 AAGAGGCACAAGGAAGTCTTTGG - Intergenic
1116760731 14:49010094-49010116 ATGAGGGACAAATAAGTTGAGGG - Intergenic
1117494718 14:56291341-56291363 AAGATGGAAAAAGAAGTTGGGGG + Intronic
1117552656 14:56851508-56851530 GAGAGGAGCAAGGGAGTTGAGGG + Intergenic
1118091007 14:62478191-62478213 AAGAGGGGCAAGGAACTTTTGGG - Intergenic
1118121599 14:62850751-62850773 CAGAGGGGCAGGGAAGTTGCGGG - Intronic
1118268704 14:64320975-64320997 AAGATGGGGAAGGAAGTTTATGG + Intronic
1119503993 14:75155748-75155770 AAGAGGGGTAAAGAAGTTCAGGG + Intronic
1119878738 14:78082638-78082660 AAGAGGGAGAAGGAAGGAGCTGG - Intergenic
1119906128 14:78303738-78303760 AAGAGGGAGAAGCATGTTCAAGG - Intronic
1119996471 14:79258900-79258922 AAAAGGGCCATGGAAGTTGAAGG - Intronic
1120357176 14:83449554-83449576 AAGGGGAACAAGGTAGTGGATGG + Intergenic
1120441228 14:84543061-84543083 AAGAGGAACCAGAAAATTGAAGG + Intergenic
1121429937 14:93879424-93879446 AATAGGGACAAGCAACTAGATGG - Intergenic
1121771868 14:96552632-96552654 AAGAGGGAAATAGAAGTGGAGGG + Intronic
1122826696 14:104374148-104374170 AAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1123505037 15:20933511-20933533 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123562282 15:21507205-21507227 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123598527 15:21944492-21944514 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1125280388 15:38036407-38036429 AAGAGAGAGAAGGATGTTGTAGG - Intergenic
1125476911 15:40053994-40054016 AAGAGTGAGAAGAAAGTTGGGGG + Intergenic
1125684548 15:41556123-41556145 AAGAGAGATAAGGAAGTAAAAGG + Intergenic
1126114595 15:45197457-45197479 AAGGGGGACACGGGAGTGGAGGG + Intronic
1126262310 15:46708063-46708085 GAGAGGGACAAAGAAATTTAGGG - Intergenic
1126464245 15:48946452-48946474 AGGAGGGAGAAGGAAGAGGAAGG - Intronic
1126674878 15:51152440-51152462 AAGAGGAAGAAGGAAGAAGAAGG + Intergenic
1127124512 15:55799218-55799240 AAGAGAGAGAAGGAAGATAAAGG - Intergenic
1127665520 15:61142313-61142335 AAAATGGAAAAGGAAGATGAAGG - Intronic
1127892666 15:63269137-63269159 AAGAGGGACAGGGAAGAGGTAGG - Intergenic
1128079234 15:64846282-64846304 TATAGGAACAAGGAAGTAGAAGG - Intronic
1128095835 15:64954727-64954749 AAGAAGGAGAAGGAAGAAGAAGG - Intronic
1128105406 15:65040651-65040673 AAGAGGAATGAGGAAGTGGAGGG + Intergenic
1128617487 15:69121582-69121604 AAAAGGGAAAGGGAAATTGAAGG - Intergenic
1129421274 15:75428865-75428887 AGGAGGGAGAAAGAAGATGAAGG - Intronic
1129532329 15:76278416-76278438 GAGGAGAACAAGGAAGTTGAAGG - Intronic
1129569401 15:76663723-76663745 AAGAGGAACAAAGAACTTTATGG + Intronic
1129713257 15:77832319-77832341 AAGAGGGACAAGGATATTCCAGG - Intergenic
1131284695 15:91047713-91047735 AGGAGGGAGGAGGAAGGTGAAGG - Intergenic
1131342784 15:91618322-91618344 AAGAGGGCCAAAGAAGTTGAGGG + Intergenic
1131671529 15:94624893-94624915 GAGAGGGACAAGGGAATTGAGGG + Intergenic
1202970627 15_KI270727v1_random:234347-234369 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1133392793 16:5422914-5422936 AGGAGGGAGAAGGAGGATGAGGG + Intergenic
1133429786 16:5726460-5726482 AAGCGGGACAAAGAAAGTGAAGG - Intergenic
1133519052 16:6539273-6539295 CAGAGGCACAAGGAAATTGAAGG - Intronic
1134324388 16:13193715-13193737 AGGAGGGAGAATGAAGTGGAAGG + Intronic
1134523538 16:14928877-14928899 AAGGGGGATAAGAAAGATGAGGG - Intronic
1134549354 16:15132043-15132065 AAGGGGGATAAGAAAGATGAGGG + Intronic
1134711132 16:16327361-16327383 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134718982 16:16370662-16370684 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134948442 16:18341222-18341244 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1134955699 16:18381332-18381354 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1135195873 16:20394139-20394161 AAGAAGGTCAAGGAAGGTGAGGG + Intronic
1135263386 16:21000372-21000394 AAGGTGGAGAAGGAAGTTGTTGG + Exonic
1135499127 16:22978431-22978453 AAGGGGCAGAAGGAAGGTGAGGG + Intergenic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1135823528 16:25705695-25705717 AAGAAAGAAAAGGAAGCTGAAGG + Intronic
1136136160 16:28258243-28258265 AGGAGGACCCAGGAAGTTGAGGG + Intergenic
1136554760 16:31001338-31001360 GACAGGGAAAAGGAAGTTGTCGG + Intronic
1137236056 16:46619383-46619405 AACAGGGACAAAGAAATGGAAGG - Intronic
1138199358 16:55077614-55077636 AAATGGGACAAGGAGGATGAAGG + Intergenic
1138263656 16:55643944-55643966 AAGTGGGGCAAAGAAGTGGAGGG + Intergenic
1138652426 16:58468288-58468310 AACAGGGACAAGGAAGGCGGGGG + Intronic
1140204768 16:72924813-72924835 AAGAGAAAAAAGGAAGTTAAAGG - Intronic
1141801261 16:86310996-86311018 AGGAAGGACCAGGAAGATGAAGG - Intergenic
1142350285 16:89576410-89576432 AAGAGGCGCAAGGAGATTGAGGG + Intronic
1143442564 17:6986781-6986803 CTGAGGGTCAAGGAAGTTGTAGG - Intronic
1143679887 17:8468417-8468439 AGGAAGGACCAGGATGTTGAGGG + Intronic
1143771461 17:9171670-9171692 AACAGCCACAAGGAAGCTGAGGG + Intronic
1143970090 17:10789201-10789223 AGGAGGGAAAAGGAAGGAGAGGG - Intergenic
1144187672 17:12811420-12811442 GAGAGGGAGAAGGAAGAGGATGG + Intronic
1145113904 17:20190416-20190438 AAGAGGGACAAGAAATGGGAAGG - Intronic
1145208480 17:20996853-20996875 AAGAGGGGGAGGGAAGTTGGGGG - Intergenic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1146669347 17:34726160-34726182 AAGAGGGATGAGGAAGCTGTGGG - Intergenic
1147510404 17:41064204-41064226 AAGAGTGAAGAGGAAGATGATGG - Intergenic
1147544301 17:41388468-41388490 AATAGGAACAATGAAGTTTATGG - Intronic
1148389442 17:47260289-47260311 AAGTGGGACAGAGAAGATGAAGG + Intronic
1148395877 17:47307794-47307816 AAGAGGCTGAAGGAAGCTGAAGG - Intronic
1148512142 17:48180312-48180334 AAGAGGGAGAAGGAGGAGGAGGG + Intronic
1150068133 17:62128749-62128771 AAGAGGCACAAGGAAGTTCCTGG + Intergenic
1150148541 17:62791544-62791566 AAGAGGAACAAGGAACTAGAGGG - Intronic
1150184248 17:63163035-63163057 AAGAGGATCAAGGGAGTTGAGGG + Intronic
1150338168 17:64344908-64344930 AAGAGGGACCAGTTAGGTGATGG + Intronic
1152598367 17:81249231-81249253 AGGAGGGAGAAGGAAGGTGGGGG + Intronic
1153050001 18:893180-893202 AAAAGGAAAATGGAAGTTGAGGG + Intergenic
1153658420 18:7305589-7305611 AAGAGGAATAATGAAGTGGATGG + Intergenic
1153678333 18:7476186-7476208 CAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1154490352 18:14917381-14917403 AAGATGGAAGAGGAAGGTGAGGG - Intergenic
1155298703 18:24409150-24409172 ATGAGGGACAAGGAAGATAAAGG + Intergenic
1155529864 18:26756197-26756219 AAGAGGAGCCAGGAAGTTGGGGG - Intergenic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1157330264 18:46698930-46698952 AACATGTACAAGAAAGTTGATGG + Intronic
1157332310 18:46712836-46712858 AAGCAGGACAAGGAATTGGAGGG + Intronic
1158008590 18:52702279-52702301 GAGAGGGACAAGGAGGTTGGTGG - Intronic
1158019829 18:52828351-52828373 AAGAGGGACAACAAACATGATGG - Intronic
1158185610 18:54768072-54768094 AGGAGAGACAAGGAAGATGTGGG + Intronic
1159044820 18:63359278-63359300 AAGAGGGACAAGGCTGCTGTGGG + Intronic
1159261844 18:66023759-66023781 AGTAGGGAAAAGGAGGTTGAAGG + Intergenic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG + Intronic
1161918331 19:7247393-7247415 AAGAGGAACAAGGAAGGAGTAGG - Intronic
1162641346 19:12012683-12012705 AAGAAGGACCAGGAAGATAAAGG - Intergenic
1163211698 19:15845597-15845619 AAGAGGGAGAAGGAAGAAGGAGG + Intergenic
1164856854 19:31531494-31531516 GAGTGGGACGAGGTAGTTGAGGG - Intergenic
1166001457 19:39879903-39879925 AAGAGGGAGGAGGACCTTGAGGG + Intronic
1166004240 19:39896154-39896176 AAGAGGGAGGAGGACCTTGAGGG + Intronic
1167191187 19:47991376-47991398 GAGAGGGACAAGGAAGAAGTGGG - Intronic
925107261 2:1302367-1302389 GGGAGGGAAAAGGAAGGTGAAGG + Intronic
925396259 2:3535694-3535716 GAGAGGGACAAGGAAGTCACGGG + Intronic
926945743 2:18185751-18185773 AAGAGGGCCAAGGCAGGAGAGGG + Intronic
927179193 2:20432324-20432346 GAGAAGGAAAAGGAAGATGAGGG + Intergenic
928037745 2:27841117-27841139 AAGAGCTACACGGAAGGTGATGG + Intronic
928635223 2:33238836-33238858 ATGAGGTAGAAGGAAGATGAAGG + Intronic
928867337 2:35932963-35932985 AAGAGGGAGAAGGAAACTAAGGG - Intergenic
928972785 2:37049306-37049328 AAGAGGGACAAGGAAAGGGAGGG + Intronic
929002928 2:37366028-37366050 GAAAGGGGCAAGGGAGTTGAGGG + Intronic
929753380 2:44740745-44740767 GAGAGGGACAAGGAAGTTGAGGG + Intronic
929834881 2:45386294-45386316 AAAGAGGACAAAGAAGTTGAGGG - Intergenic
930068664 2:47347700-47347722 AGGAGGTACAAGGAAGCTGGAGG - Intronic
930094500 2:47556658-47556680 GAGAGGGGCAAGGAAGTTAAGGG + Intronic
930617459 2:53608338-53608360 AAGAGGGACAAGAAAGGGGGTGG + Intronic
931063111 2:58553586-58553608 AAGGGGGAAAAGGAAGGAGAAGG - Intergenic
931992781 2:67807805-67807827 AAGAAGGAGAAGGAAGAAGAAGG - Intergenic
932779543 2:74551392-74551414 AAGAGTCACAAGGACTTTGATGG - Intronic
934724176 2:96604500-96604522 AAGTGGGACAAAGAAGCTGAAGG - Intronic
935760857 2:106319412-106319434 AGAAGGGGCCAGGAAGTTGAGGG - Intergenic
936696091 2:114949910-114949932 CAGAGAAACAAGGAATTTGATGG - Intronic
937013397 2:118581850-118581872 AAGAGGAACAAGGAGCTTGGGGG - Intergenic
937894892 2:126971321-126971343 GAGAGGGACGAGGAATTTGGCGG - Intergenic
938200582 2:129369347-129369369 AAGTGTGACAGGGATGTTGAGGG - Intergenic
938584371 2:132674692-132674714 AAGAGAGAGATGGAAGTGGATGG + Intronic
938800063 2:134754248-134754270 AAGAAGGACAAAGAAGGTCATGG + Intergenic
938982682 2:136541468-136541490 GTGAGTGACAGGGAAGTTGAGGG + Intergenic
938994049 2:136658782-136658804 AGGAGGGACATGGAGGTTAAGGG + Intergenic
939073190 2:137568307-137568329 GAGATGGGCAAGGAAATTGATGG + Intronic
939810025 2:146820161-146820183 AAGAGTGCTAAGAAAGTTGAAGG - Intergenic
940623558 2:156144740-156144762 AAGAGGGACATGTAAGTTACAGG - Intergenic
940763817 2:157768140-157768162 AAGAGAGAGAAAGAAGTAGAGGG - Intronic
940927055 2:159375777-159375799 CAGAGGGGCAAGGGAGATGATGG + Intronic
941413101 2:165185348-165185370 AAGATGGGCAAGGGACTTGAAGG - Intronic
942276663 2:174328252-174328274 AAGAGGGAGGAGGAAGAGGAGGG + Intergenic
943668620 2:190636867-190636889 AAGGGGGAGGAAGAAGTTGAGGG - Intergenic
943709229 2:191071848-191071870 GAGAGGGAAAAGGAAGGGGATGG + Intronic
943795546 2:191988391-191988413 AAGAGCACCAGGGAAGTTGAAGG - Intronic
943926209 2:193783776-193783798 AAGAGGGAGAAGAAAGATCAAGG + Intergenic
944542531 2:200767327-200767349 AAGAGGGCCATGGAAGATGGAGG - Intergenic
945786781 2:214249399-214249421 AAGAAGGAGAAGGAAGAGGAGGG + Intronic
945978787 2:216291996-216292018 CATAGGGACAAGGAAGGTAAGGG - Intronic
946748623 2:222870706-222870728 AAGGGAGACAAAGAAGTGGATGG + Intronic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
947329041 2:229009086-229009108 AAGAGTTCCAAGGAAGATGAAGG - Intronic
947505864 2:230708119-230708141 AACAGGGGAAAGGAAGGTGAAGG - Intergenic
947690054 2:232126933-232126955 AAGAGAAATAAGGAAGTTGAAGG - Intronic
948730797 2:239962575-239962597 AAGTGGGACCTGGAAGTGGAGGG + Intronic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1168789178 20:564438-564460 AAGAGAGTGAAGGAAGATGAGGG + Intergenic
1169251670 20:4065892-4065914 AAGAGAGTCATGGAAGCTGAAGG - Intergenic
1170056781 20:12214171-12214193 AAGAAGCACAAGGAAGAAGAAGG + Intergenic
1170191386 20:13648534-13648556 CAGAAGGACAGGGAAGCTGATGG - Intergenic
1171033742 20:21700199-21700221 ATAATGGACAAGGAAGGTGAAGG - Intergenic
1171205124 20:23273103-23273125 ATGAGGGACATGGAAGAGGATGG + Intergenic
1171207234 20:23290615-23290637 AAGAGAGTCAAGGAAATTCAAGG - Intergenic
1172357103 20:34287889-34287911 AAGACTGTCAAGGATGTTGAGGG + Intronic
1172708663 20:36902674-36902696 AAGAAGGAAAAGAGAGTTGAGGG + Intronic
1173126442 20:40340381-40340403 AACAGGGACCAGGAACTTGTGGG + Intergenic
1173644880 20:44627027-44627049 ATGAGGGAGAAGGAAGGTGCTGG - Intronic
1174212528 20:48891162-48891184 AAGAAGGAGAAGGAAGAAGAAGG + Intergenic
1174720500 20:52806806-52806828 ATGAAGGACATGGAAGATGAAGG + Intergenic
1176956064 21:15105387-15105409 AAGAGGGAAGAGGAAGAAGAGGG - Intergenic
1177176202 21:17703258-17703280 AAGAGGGTCAAGGGAGGTGCTGG - Intergenic
1177379389 21:20319301-20319323 AAGAGGGAGAAGGAGGGAGAGGG + Intergenic
1177379394 21:20319317-20319339 GAGAGGGACAAGGAGGGAGAGGG + Intergenic
1178096047 21:29217011-29217033 AAGGAGGACCAGGAAGTAGAAGG + Intronic
1178167032 21:29991061-29991083 AAGAAGGACCCGGAAGTTCAAGG + Intergenic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178643207 21:34363381-34363403 AAGAGGAAGAAGGAAGAAGAAGG - Intergenic
1178982124 21:37273518-37273540 AAGAGGGAGAAGGAGGAGGAGGG + Intergenic
1180467467 22:15626302-15626324 AAGAGAGACAAGAAAGGTGGGGG + Intergenic
1181489945 22:23255449-23255471 AAGAAAGACAAGACAGTTGAGGG - Intronic
1181884891 22:26012945-26012967 AATGGGCACAAGGAAGTTGTAGG - Intronic
1181910128 22:26231931-26231953 ATGAGGGACATGCAAGTGGAGGG + Intronic
1182298680 22:29326205-29326227 GGGAGGGACAGGGAAGCTGAAGG + Intergenic
1182547379 22:31084105-31084127 AAGAGGAACAAGAAAGGGGATGG - Intronic
1182595696 22:31418481-31418503 ATGAGGAACTAGAAAGTTGATGG + Intronic
1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG + Intergenic
1183095255 22:35548096-35548118 AGGAGGGACAGGGAGGTTGGGGG + Intronic
1184092484 22:42299829-42299851 AAGGGGGAGAAGGAAGCGGAGGG + Intronic
1184955115 22:47880840-47880862 GAGAGTGACAAGGAAATTCATGG - Intergenic
1185116607 22:48941621-48941643 AAGAGGGAGAAGGAAGTGCTCGG + Intergenic
949388984 3:3537768-3537790 AAGAGGAAAATGGGAGTTGACGG + Intergenic
950145631 3:10647765-10647787 AAGAGAGAAAAAGAAGTTGATGG + Intronic
950715170 3:14842662-14842684 GAGAAGGACAAGGAAGCTGCTGG - Intronic
950912980 3:16614266-16614288 AAGAGGTCCAGTGAAGTTGATGG - Intronic
951470555 3:23051726-23051748 AAGAGGGATAGGGAAATTGAAGG + Intergenic
951481565 3:23167413-23167435 AAGAGAAACAAGAAAGTAGAAGG + Intergenic
951806213 3:26646941-26646963 AAGATGGAGAAGGAAGATGTGGG - Intronic
951982052 3:28576281-28576303 AAGATGGAGATGGATGTTGAGGG + Intergenic
952810009 3:37393532-37393554 AAGAGGGGTAAGGAAGCTGCAGG + Intronic
953374862 3:42420078-42420100 AAGAGAGACAAGAAAGGAGAGGG + Intergenic
953466685 3:43127849-43127871 TAGATAGACAAGGAAGTTGGGGG + Intergenic
953607846 3:44423643-44423665 AAGAAGGTGAAGGAATTTGATGG - Intergenic
953744786 3:45566082-45566104 AAGAGGGGCCAGGTGGTTGAGGG + Intronic
954431142 3:50471438-50471460 AAGAGGAAGAAGGAAGCTGGTGG - Intronic
955295536 3:57731920-57731942 AAGAGGAAAAAGGAAAATGAAGG + Intergenic
956747859 3:72323700-72323722 AAGAGGAACAAGGAAGAAGCTGG - Intergenic
957515849 3:81250087-81250109 AAGAGGGACAAGGAAGAAAATGG - Intergenic
957556001 3:81765192-81765214 AAGAGGGAGAACTAAGTTCAAGG + Intergenic
958061270 3:88484614-88484636 ATGAGGGAAAAGGGAGTTGATGG + Intergenic
959532745 3:107452084-107452106 CAGAAGGACAAGCAAGCTGAAGG - Intergenic
960438970 3:117663368-117663390 AAGACAGAGAAGCAAGTTGATGG + Intergenic
960586130 3:119322906-119322928 AGGAGGGACAAGGACGTGGAAGG - Intronic
961911211 3:130318397-130318419 AAAGAGGACAAGGAAATTGAAGG - Intergenic
962463022 3:135631976-135631998 GAGAAGGCCAAGGAGGTTGAGGG - Intergenic
962492432 3:135907488-135907510 AAGAAGAACATGGAAGTTGTAGG - Intergenic
962660219 3:137594686-137594708 AATAGGGACAAGGTAATAGAAGG - Intergenic
964455619 3:156862579-156862601 AAAAGGAAAAAGGAAGGTGAGGG - Intronic
965422794 3:168482880-168482902 AAGATGTACAGGGAAGATGATGG - Intergenic
965865312 3:173198526-173198548 AAGAGAGAGAAGGAAGTTTCAGG + Intergenic
965905180 3:173696656-173696678 AAGAAAGAAAAGGAAGGTGAAGG - Intronic
967127405 3:186436193-186436215 AAGAGGGAGAGGGAGGTGGAGGG + Intergenic
967186398 3:186948269-186948291 AAGAGGGACCAGGAAGGATAGGG + Intronic
967350672 3:188511035-188511057 GAGAGGGAGAAGGAAGGGGAGGG - Intronic
967437409 3:189464840-189464862 AAAAGGGACAAGTTATTTGATGG + Intergenic
968079297 3:195835390-195835412 AAGAGGAACAAGGAAGTAAGGGG + Intergenic
968361149 3:198147836-198147858 AAAACGGACAGGAAAGTTGAGGG + Intergenic
969399210 4:6942747-6942769 ACGAGGAAGAAGGAAGGTGAGGG + Intronic
969444880 4:7239113-7239135 AGGAGGGACAGGGACTTTGAAGG - Intronic
969721565 4:8895236-8895258 AAGAGGGCCAAGGTGGATGATGG + Intergenic
969954772 4:10877628-10877650 AAGAAAGACCAGGAAGTTGCTGG + Intergenic
970102201 4:12537531-12537553 AAGAAGGACAAGGAATGTGGGGG - Intergenic
971461661 4:26905319-26905341 GAGAAGGGCAAGGAAGTCGAGGG + Intronic
971786213 4:31106202-31106224 AAGTGGGACAAGAAAGTCAATGG - Intronic
972401734 4:38710795-38710817 AAGAGGGAGAAGAAAGTTCAGGG + Intergenic
974226273 4:59049544-59049566 AAGAGTGAAGAGGAAGCTGAAGG + Intergenic
975720917 4:77247869-77247891 GAGTGGGGCAAGGAAGTTGAAGG + Intronic
975724099 4:77275490-77275512 GAGTGGGGCAAGGAAGTTGAAGG + Intronic
976124478 4:81818941-81818963 AAGAGTGAGAAGGGAGTTGTTGG + Intronic
977077872 4:92480895-92480917 AAGAGCTACAATGAAGTAGAAGG - Intronic
977834002 4:101627423-101627445 AACAAGGACAAGATAGTTGAAGG + Intronic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
978628768 4:110718811-110718833 AAGAGGAGCAAGGAGGTTTAGGG - Intergenic
978827821 4:113046092-113046114 GACAGGCACAAGGAAATTGACGG + Intronic
979570075 4:122212074-122212096 GAGAGGGACTAGGATGTTTAGGG + Intronic
979833958 4:125338209-125338231 AAGATGGACATGGAAGCAGAAGG + Intronic
980100768 4:128539273-128539295 AAGAGGGACAGGGAAGTGCTGGG - Intergenic
980171453 4:129294864-129294886 AAGAGAAGCAAGAAAGTTGAGGG + Intergenic
980208821 4:129758276-129758298 GAGAGGGACAAAGGAGTTGATGG - Intergenic
980788181 4:137581546-137581568 AAAAGAGAGATGGAAGTTGATGG + Intergenic
982417445 4:155152458-155152480 AAGATGGAACAGGCAGTTGATGG - Intergenic
982684626 4:158473412-158473434 AAGAGGCACAAGGAAGTCTTTGG - Intronic
983095826 4:163560373-163560395 AAGACTGACAAGTAAATTGATGG - Intronic
983626456 4:169806597-169806619 AAAAGGCACAAGGAAATGGATGG + Intergenic
984293083 4:177819624-177819646 CAGTGGGACAAGGAAAATGATGG - Intronic
984418748 4:179492644-179492666 AAAAGGGAAAAGGAAGTCAAAGG - Intergenic
984453820 4:179939323-179939345 GAAGGGGACAAGGGAGTTGAGGG + Intergenic
984753113 4:183297767-183297789 AAGAGAGACAAGGGAGGAGATGG + Intronic
984895132 4:184532492-184532514 AAAATGGAGAATGAAGTTGAAGG + Intergenic
985117485 4:186605752-186605774 AAGAGGGAAGAGGAAGGTCAAGG + Intronic
986682812 5:10249485-10249507 CCGAGGGACAAAGAAGTTAAGGG + Intronic
986748118 5:10761450-10761472 GAGAGGGAGAAGGAAGGAGAGGG + Intergenic
987007405 5:13724546-13724568 AAGAAGGACATGGGATTTGAGGG + Intronic
987518602 5:18948267-18948289 AAGAAGGAGAAGGAAGGAGATGG + Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988331919 5:29852226-29852248 AAGATGGAGGAGGAAGTTAAAGG - Intergenic
988447422 5:31303438-31303460 AAGAGGTACCAGGAAATTTATGG - Intronic
988492423 5:31716408-31716430 AGGAGGCAGAAGGAAATTGAGGG + Intronic
989658232 5:43768422-43768444 AAGAGGGACAAAGCAATTGAAGG + Intergenic
989738926 5:44745945-44745967 AAAAATGACAAGGAAGTTAATGG - Intergenic
993238546 5:85347981-85348003 AAGAGAGACAATGATGCTGAAGG - Intergenic
994144051 5:96372763-96372785 AAGAGGGTCACAGAAGATGAAGG - Intergenic
994910501 5:105899240-105899262 AAGAGAGACAATGCAGTGGAAGG - Intergenic
995085120 5:108099567-108099589 AGAAGGGACTAGGAAGATGAAGG + Intronic
995358863 5:111270426-111270448 ACCAGGGACAAGGGAGTTGAAGG - Intronic
995669007 5:114578948-114578970 AAGAGGGAGGAGGAATGTGAGGG - Intergenic
1002210561 5:177596473-177596495 GGCAGGGACAAGGATGTTGATGG + Intergenic
1003301020 6:4883055-4883077 AAGAGGGACAAGGCAATTTTAGG - Intronic
1004482685 6:16036070-16036092 CAGAGGACAAAGGAAGTTGAAGG - Intergenic
1005091277 6:22059431-22059453 AAGAGGGACGAGAAAGGTTATGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006577785 6:35058702-35058724 AAGAGGTACAAGGAAGGAAAAGG - Intronic
1007028857 6:38607975-38607997 AAGAGGAAGAAGGAAGTTTCAGG - Intronic
1008484563 6:52021738-52021760 AAGAGGGAAGAGGAAGAAGAAGG - Intronic
1008690309 6:53971451-53971473 AAGAGGAAGAAGGAAGGTGAAGG + Intronic
1008702263 6:54115289-54115311 AAGGAGGACAAGGGATTTGAGGG + Intronic
1009778124 6:68232814-68232836 AAAAGGGAAAAGGAAGGTGTTGG + Intergenic
1009932653 6:70194393-70194415 AAGGGGCACCAGGATGTTGAAGG - Intronic
1010273366 6:73940164-73940186 AAAAGAGAGAAGGAAGTAGAAGG - Intergenic
1011119140 6:83931363-83931385 AAGAAGGAGAAGCCAGTTGAAGG + Intronic
1012183855 6:96189251-96189273 GAGAGGGACAAGCATGGTGATGG + Intronic
1012381179 6:98621067-98621089 AAGAGGGAAAGAGAAGATGAGGG - Intergenic
1013111437 6:107068345-107068367 AAGAGGGGCAAGAGAGTTGCTGG + Exonic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1014824801 6:126036930-126036952 AAGAGCCACAGGGAAGCTGAAGG - Intronic
1015172687 6:130271331-130271353 CACAGGGATAGGGAAGTTGAGGG - Intronic
1015203782 6:130612430-130612452 AATAGGGACAAGGAAGTTGGGGG + Intergenic
1015698813 6:136012062-136012084 AAGTAGAACAAGGAAGTTAAAGG - Intronic
1016101137 6:140101721-140101743 ATGATAGACATGGAAGTTGAGGG + Intergenic
1016420946 6:143882566-143882588 AACAGGGTCATGGAAATTGAAGG - Intronic
1016989392 6:149918853-149918875 AGGAGGGAGAAGGAAGAGGAGGG + Intronic
1016993741 6:149946821-149946843 AGGAGGGAGAAGGAAGAGGACGG - Intronic
1017004590 6:150020715-150020737 AGGAGGGAGAAGGAAGAGGAGGG + Intronic
1017197628 6:151718794-151718816 AACAGGGAGAACAAAGTTGAAGG - Intronic
1017952315 6:159146277-159146299 AAGAGGGAAAATGTAATTGAAGG - Intergenic
1018038068 6:159898626-159898648 AAGAGGGAGGAGGAAGAAGAGGG - Intergenic
1018320160 6:162600110-162600132 AAGAGGCACAAGGAAGCTATTGG - Intronic
1018623881 6:165758681-165758703 AAGAAGGAGAAGGAAGGAGAAGG + Intronic
1018702856 6:166441136-166441158 TAGATGGACAAGGAAGGAGACGG - Intronic
1019056364 6:169226229-169226251 CAGAGGGACACGGATGGTGACGG - Exonic
1019085096 6:169468161-169468183 ATGATGGACAATGAAGTTCAGGG - Intronic
1019254538 7:40885-40907 AAAACGGACAGGAAAGTTGAGGG - Intergenic
1019825398 7:3280091-3280113 AAGAGGGACAGGCAAATGGAAGG - Intergenic
1020961339 7:14807024-14807046 AGGAGAGACAAGGAAGTTCTTGG + Intronic
1021280239 7:18708145-18708167 AGGAGGGGGCAGGAAGTTGAGGG + Intronic
1021301635 7:18980697-18980719 AAGAGGAAGAAGGAAGAAGAAGG - Intronic
1021307012 7:19045035-19045057 AATAATGACATGGAAGTTGAAGG - Intronic
1022037812 7:26550584-26550606 AAGAGGGAGGAGGAAGAAGAAGG + Intergenic
1022289582 7:28988081-28988103 TAGAGAGACAAGGAAGGTGTGGG - Intergenic
1022320170 7:29280440-29280462 TAGAGGGACAGGAAAGTTAATGG + Intronic
1022334961 7:29413595-29413617 AGGAGGAACAATGAAGTTAAGGG - Intronic
1022674803 7:32489278-32489300 AAGAGTGATAAGGAAATTGTTGG - Exonic
1022732189 7:33038462-33038484 AAGAGTGATAAGAAATTTGATGG + Intronic
1023115706 7:36859946-36859968 ATGAGGGAGAAGGAAGAGGACGG - Intronic
1023888563 7:44377118-44377140 AGGAGGGACAAGGAGGGAGAGGG - Intergenic
1025971491 7:66330269-66330291 AGGAGAGGCAAGGGAGTTGAAGG + Intronic
1026443023 7:70460228-70460250 AGGAGGGACCAGAAAGGTGAGGG + Intronic
1027048535 7:75007185-75007207 AACAGGGACATGGGTGTTGAGGG + Intronic
1027411136 7:77918951-77918973 AAGAAGGACAAGGAAGGAAAGGG + Intronic
1027572070 7:79882146-79882168 AAGAGGCACAAGGAAGTCTTTGG - Intergenic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1028366195 7:90035647-90035669 AAGATGGTCAAGGAAGTTAAGGG + Intergenic
1028982941 7:96987125-96987147 AAGTGGGAAAAGAAAGTTTAGGG - Intergenic
1029349131 7:100000608-100000630 AGGTGGGAGAAGGAAGTTTAGGG + Intergenic
1029384478 7:100234464-100234486 AACAGGGACACGGGGGTTGAGGG - Intronic
1030006951 7:105129253-105129275 TAAAGGAACAAGGAAGATGAAGG + Intronic
1031071615 7:117167959-117167981 AACAGAGCCAAGGAAGTTGTGGG + Intronic
1031120869 7:117720173-117720195 AAGAGAGAGAAGGGAGATGAAGG - Intronic
1032427047 7:131830695-131830717 AAGAGCTACAAGGAGGTTGATGG - Intergenic
1032542491 7:132714930-132714952 AGGAGGGATAGGCAAGTTGATGG - Intronic
1033143394 7:138848630-138848652 AAGAAGGACAAGGACATTGCAGG - Intronic
1033296697 7:140144891-140144913 AAGAGGTACAAGGGAGTGGGAGG - Intronic
1033671987 7:143501918-143501940 AAGATGGAGAAGGAAAGTGAGGG + Intergenic
1033678247 7:143566204-143566226 GAGAGGGACAATGAACTTGGAGG + Intergenic
1033691050 7:143737598-143737620 GAGAGGGACAATGAACTTGGAGG - Intergenic
1033693594 7:143763242-143763264 GAGAGGGACAATGAACTTGGAGG - Intergenic
1034073004 7:148205912-148205934 AACAGGGATAAGGAGGTTAAAGG - Intronic
1034308681 7:150068394-150068416 AACTGGGACAAGGACGTTGCAGG - Intergenic
1034798170 7:154032250-154032272 AACTGGGACAAGGACGTTGCAGG + Intronic
1035494137 7:159307087-159307109 AAGAAGGACCAGGAACTTGAAGG - Intergenic
1035960829 8:4135408-4135430 AAGAGGGGGAAGGAAGGGGAAGG + Intronic
1035983744 8:4402358-4402380 GAGAGGAACAAGGGAATTGAGGG - Intronic
1036203041 8:6785128-6785150 AAGAGGAACAAAGGAGTGGATGG - Intergenic
1037002456 8:13736671-13736693 AAGAGGGAGGAGATAGTTGAGGG + Intergenic
1037631192 8:20657917-20657939 AAATGGGACAAAGAAGTTCAGGG - Intergenic
1038033705 8:23667834-23667856 AAAAAGAAGAAGGAAGTTGAAGG - Intergenic
1038208245 8:25489973-25489995 TAGAGGGGGAAGGAAGTTTACGG - Intronic
1038845469 8:31225506-31225528 AACAGGAACAACGTAGTTGATGG - Intergenic
1039990162 8:42481023-42481045 GAGAAGGATAAGGAAGATGAGGG - Intronic
1040751281 8:50712227-50712249 AGGATGGACATGGAATTTGAGGG + Intronic
1040911478 8:52523482-52523504 AATAGGGACAAGAAAGAAGAAGG - Intergenic
1041467068 8:58167516-58167538 GAGAGGCAGCAGGAAGTTGAGGG - Intronic
1041961569 8:63623220-63623242 AAGAGGGAGAAGGGACTTGGTGG + Intergenic
1045420264 8:102007733-102007755 CAGAGGGAGGAGGAAGTAGAAGG - Intronic
1045435607 8:102160565-102160587 AAGAGTGAAATGGAAGTTTAAGG - Intergenic
1046046045 8:108966270-108966292 AATAGGGATAAAGAGGTTGATGG + Intergenic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047037535 8:120955917-120955939 AACAGGGAGAAGGAGGTAGAGGG + Intergenic
1047827031 8:128587942-128587964 CAGAGGGATAAGAAAGTTTAAGG - Intergenic
1048088737 8:131214572-131214594 AAGAGGCAGAAAGAAGGTGAGGG + Intergenic
1048374216 8:133808183-133808205 CAGCGGAAAAAGGAAGTTGAGGG + Intergenic
1048788432 8:138077292-138077314 AGGAGGGAAAAGCCAGTTGAAGG - Intergenic
1049195329 8:141312678-141312700 CAGAGGGCCAGGGAAGCTGAGGG - Intergenic
1049295991 8:141838820-141838842 AAGAGGGACAAGAAAACAGATGG - Intergenic
1050196587 9:3090745-3090767 AAGAAGGAAAAAGAAGATGAGGG - Intergenic
1050259690 9:3828375-3828397 AAGAGGCTCGAGGAACTTGAAGG + Exonic
1050795228 9:9531314-9531336 GACATGGACAAGGAAATTGAGGG + Intronic
1050801990 9:9626893-9626915 AAATGGGAGAAGCAAGTTGAAGG + Intronic
1050830508 9:10005659-10005681 CAGAGGGACAAGATAGGTGAGGG - Intronic
1051342392 9:16123598-16123620 AAAAGGAAAAAGGTAGTTGAAGG - Intergenic
1051377316 9:16415767-16415789 AAAAGGGACAGGGGAGTGGATGG - Exonic
1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG + Intronic
1051872086 9:21749627-21749649 AAGAGGTACAGGGGTGTTGAAGG - Intergenic
1052306789 9:27019311-27019333 GAGAGGGATAAGGGAGGTGATGG - Intronic
1052367677 9:27631428-27631450 AAGAGGGCCAAAGAAGATGTTGG + Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1052841453 9:33294851-33294873 GAGAGTGAGAAGGAAGTTGTGGG + Exonic
1053389640 9:37725011-37725033 AGTAGGGACAGGGCAGTTGAGGG + Intronic
1054826604 9:69579776-69579798 AAGTGGGTCAAGGAAGAGGAAGG + Intronic
1056071570 9:82992620-82992642 GAGAGGGAGGAGGAAGATGATGG + Intronic
1057226444 9:93295776-93295798 TGGAGAGACAAGGAAGGTGAAGG - Intronic
1057292265 9:93814261-93814283 AAGGGGGACGAGGAAGGTGGGGG - Intergenic
1059718675 9:116937278-116937300 AGGTGGGAGAAGGAAGCTGAGGG - Intronic
1060686291 9:125615936-125615958 AAAAGAGAAAAGGAGGTTGAAGG + Intronic
1060691704 9:125667048-125667070 AAGAGAGAGAAGGAAACTGAAGG + Intronic
1061099899 9:128484645-128484667 AAGAGAGACAAGGAGGTTGTGGG - Intronic
1061105916 9:128530299-128530321 AAGAGGGCTAAGGAAGATGATGG - Intronic
1061378643 9:130241184-130241206 AAGAGGGAAAAGGCAGAAGACGG - Intergenic
1061645642 9:131998821-131998843 AGGAGGGAAAAGGAAATTGGTGG + Intronic
1062208990 9:135353133-135353155 AAGAAGGGTCAGGAAGTTGAGGG - Intergenic
1185519015 X:724494-724516 AAAAGGAAGAAGGAATTTGACGG - Intergenic
1186499324 X:10038687-10038709 AACAGGGAGCAGGAAGCTGATGG - Intronic
1187006417 X:15237468-15237490 AAGAGGAACAATGGAGTTAAGGG - Intronic
1187369405 X:18692254-18692276 AAGGGGGACAAGCGAGTTTATGG - Intronic
1189466889 X:41284274-41284296 AAGAGGGGAAAGGCAGCTGAGGG + Intergenic
1189946152 X:46181091-46181113 AAGAAGGAAAACAAAGTTGAGGG - Intergenic
1190434579 X:50410791-50410813 AAGTGGGAAAAGAGAGTTGAAGG + Intronic
1190755944 X:53402286-53402308 AAGGGGGACAAGGGAGATGGAGG - Intronic
1190757722 X:53415177-53415199 AAGAGGGACGAGGCAGTAGAGGG + Intronic
1191849928 X:65578627-65578649 GAGAGGGAGAAGGAAGCAGAGGG + Intergenic
1191912739 X:66168297-66168319 AGGAGGGAAAAGGAAGAGGAAGG + Intronic
1192335970 X:70220074-70220096 AAGAGGGACAAGGGAGAGGTTGG + Intergenic
1192623764 X:72706772-72706794 TAGAGGGTAAAGGGAGTTGATGG - Intronic
1193655178 X:84188832-84188854 GAGAGGGACAAGTAAGGTGGGGG - Intergenic
1193834644 X:86326680-86326702 AGGAGGGACAAGGAGGGAGAAGG - Intronic
1193847844 X:86496944-86496966 AAGAGGAGGAAGGAAGGTGAAGG + Intronic
1194277438 X:91902723-91902745 ATTTGGGAAAAGGAAGTTGAAGG - Intronic
1195293441 X:103451398-103451420 AGGAGGGACATGGAAGCTGGAGG - Intergenic
1195768348 X:108320423-108320445 AAGAGGGGCAAGGGAGTCAAGGG + Intronic
1195973035 X:110494615-110494637 ACATGGGACATGGAAGTTGAAGG + Intergenic
1196763887 X:119225588-119225610 AAGAAAGTCAAGGAAGTGGAAGG + Intergenic
1198082852 X:133255318-133255340 GAGAAGGACATGTAAGTTGAAGG - Intergenic
1199537686 X:148921654-148921676 TATAGGGAGAAGGAATTTGATGG + Intronic
1199679252 X:150214229-150214251 AAGAGGGTCAGGGAAGGAGATGG + Intergenic
1199971512 X:152865294-152865316 AAGAGGGTCAGAGAAGGTGAAGG - Intronic