ID: 978468330

View in Genome Browser
Species Human (GRCh38)
Location 4:109033020-109033042
Sequence TCCCACCAGGTCCTCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978468326_978468330 28 Left 978468326 4:109032969-109032991 CCAAGGTAGACATTTGTATTAAT 0: 1
1: 0
2: 1
3: 20
4: 263
Right 978468330 4:109033020-109033042 TCCCACCAGGTCCTCCATAAAGG 0: 1
1: 0
2: 1
3: 7
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978468330 Original CRISPR TCCCACCAGGTCCTCCATAA AGG Intronic
900290974 1:1923471-1923493 TCCCACCAGATCCTGCTGAAGGG - Exonic
901451658 1:9339804-9339826 TGCCACCAGGTCCACAAGAATGG - Intronic
903277656 1:22232078-22232100 ACCCACTAGGTGCTCAATAATGG - Intergenic
905336691 1:37249439-37249461 ACCCACCAGCCCCTCAATAAGGG + Intergenic
910191355 1:84599177-84599199 TCCCACCAGTTCCACCTTACAGG + Intergenic
910487484 1:87731478-87731500 TCCCACCTTGGCCTCCACAAGGG + Intergenic
911349272 1:96733142-96733164 TCCCCCCAGATCCTGCAAAAAGG - Intronic
911467785 1:98276660-98276682 TCCCACCACCTCCATCATAATGG + Intergenic
912595467 1:110871447-110871469 TCCCACCATGTCCACCATCCAGG - Intergenic
918576043 1:186061445-186061467 TCCCACCAGGTCCCTCACCAGGG + Intronic
919006755 1:191908870-191908892 TTGCACTAGGTTCTCCATAACGG + Intergenic
921739900 1:218671682-218671704 TCCCACAAGATCCTCCAGATGGG + Intergenic
923565321 1:235072174-235072196 ACCCACAAGGTCCTCCCTACAGG + Intergenic
924494708 1:244575755-244575777 TCCCACCAGCTGCTCCCTAGGGG - Intronic
1063083080 10:2786955-2786977 TCCCACCAGTTGCTCCCTCAAGG + Intergenic
1065550264 10:26862416-26862438 TGCCACCAGATTCTCCATCAAGG + Intergenic
1066364772 10:34766249-34766271 TCCCCCCACGTCCCCCATACAGG - Intronic
1068809932 10:61243936-61243958 TTCCATCAGTTCATCCATAAAGG - Intergenic
1069066166 10:63944021-63944043 TCCCACCATGTTCTCCCCAAAGG + Intergenic
1070305822 10:75238622-75238644 GCCCGGCAGGTCCTCAATAAAGG - Intergenic
1071558517 10:86626318-86626340 TCCCACCTGGCATTCCATAAAGG + Intergenic
1078306902 11:10198001-10198023 CCCCTCAAGGTCATCCATAAGGG + Intronic
1078835234 11:15021859-15021881 TGCCACTCTGTCCTCCATAATGG - Intronic
1082711778 11:56561354-56561376 TCCCACTGGGTCCTGCGTAATGG + Intergenic
1084630324 11:70344114-70344136 TCCCACAATGTCCTACAGAAAGG - Intronic
1084981384 11:72830578-72830600 TCCCACCTGGTCTTCCCGAAGGG + Intronic
1089639174 11:119835856-119835878 TCCCACCCTGTCCTCCAAAGAGG - Intergenic
1090905156 11:131068422-131068444 TCCCACTAGGACATCCCTAATGG + Intergenic
1095875978 12:47080097-47080119 TCCCACCCGGACCTCTAGAACGG + Intronic
1096878415 12:54648096-54648118 TCCCACTAGGTTCTCCACACAGG - Intronic
1097871616 12:64607031-64607053 TCCCACCTCGGCCTCCAAAAAGG - Intergenic
1098865803 12:75761991-75762013 TCCCACCAGCCCCTCAATGATGG + Intergenic
1100097516 12:91059868-91059890 TCCAACCATCTCCTCCATCATGG + Intergenic
1101752422 12:107593342-107593364 TCCCACAAGATGCTCCATGATGG - Intronic
1102189641 12:110977399-110977421 TCCCACAGGTTCCTCCAGAAAGG - Intergenic
1105283327 13:18982900-18982922 TCCCACCAAGTCCTGTCTAATGG + Intergenic
1105287599 13:19018611-19018633 TCCCAACCTGTCCTTCATAAAGG + Intergenic
1110200027 13:72839018-72839040 TCCCCACAGGTCTTACATAATGG - Intronic
1112216670 13:97437733-97437755 TTCCATCAGATCCTTCATAAGGG - Intronic
1113949943 13:114066324-114066346 TCCCACCAGGGCCTCACTGAGGG - Intronic
1115043579 14:28961158-28961180 TCCCTCCAAGTCATCCATGATGG + Intergenic
1115805957 14:37051849-37051871 TCCCACCAGGGCCTTCCTATTGG + Intronic
1117089706 14:52237564-52237586 TCCCACCATGGCCTCCCAAAAGG + Intergenic
1117162964 14:53007107-53007129 TCCCACATGGTGCACCATAAGGG + Intergenic
1117557001 14:56895921-56895943 TCCCACCTTGGCCTCCCTAAGGG - Intergenic
1119869332 14:78001915-78001937 TCCCACCAGGTCCCTTATCAGGG - Intergenic
1120730087 14:87992501-87992523 ACCCACCAACTCCTCCAAAAGGG + Intronic
1121308398 14:92921938-92921960 TCCCACCAGGTTCTCATTTAGGG + Intergenic
1202889838 14_KI270722v1_random:145735-145757 TCCCACCAGTCCCTCCATTCTGG + Intergenic
1125200139 15:37095804-37095826 TCGTACCAGGTCCCCCTTAATGG - Intronic
1125521547 15:40350576-40350598 TTCCACCAGGTCCTCCACTATGG + Intergenic
1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG + Intronic
1128881003 15:71242827-71242849 GCCCACCAGGTCCCCCAACATGG + Exonic
1129756385 15:78101592-78101614 TACCACCAGGTGCTCTCTAAGGG - Intronic
1130750216 15:86703606-86703628 TCCCACCAGGTCCTTCCACAGGG - Intronic
1133746408 16:8690270-8690292 TGGCACCAGGTCCACCTTAAGGG - Intronic
1134002557 16:10794112-10794134 TCCCACCAGCCCCTTTATAAAGG + Intronic
1135171589 16:20188903-20188925 TCCCACCTGGGCCTCCCAAAGGG + Intergenic
1136688565 16:32010736-32010758 TCCCACCTGGGCCTCCCAAAGGG + Intergenic
1136789161 16:32954259-32954281 TCCCACCTGGGCCTCCCAAAGGG + Intergenic
1136880652 16:33899679-33899701 TCCCACCTGGGCCTCCCAAAGGG - Intergenic
1138127835 16:54453415-54453437 TCCCACCTTGTCCTCCCAAAGGG + Intergenic
1139229461 16:65269466-65269488 TCAAACCAGGTCCTCCACAATGG - Intergenic
1139758459 16:69164500-69164522 TGCCAACATGTCCTCCAAAAGGG - Intronic
1140254475 16:73323174-73323196 TCCCACCAGGCCCTCCTGAAAGG - Intergenic
1141656752 16:85420794-85420816 TCCCACCAGGACCTCTAGAGAGG + Intergenic
1203091362 16_KI270728v1_random:1215752-1215774 TCCCACCTGGGCCTCCCAAAGGG + Intergenic
1147151418 17:38516922-38516944 TCCCACCTGGGCCTCCCAAAGGG + Intergenic
1148811091 17:50291796-50291818 TTCCACCAGGCCCTCTATAAAGG + Intergenic
1151345235 17:73497352-73497374 TCCCACCAGGCCATATATAAGGG - Intronic
1156541190 18:37912545-37912567 TCCCACCATGTTCTCAATGATGG - Intergenic
1157844105 18:50986622-50986644 TTCCACCAGGTCCTGCCTATGGG + Exonic
1157976730 18:52336278-52336300 TCCCAGCAGTGCCTCCATGAGGG + Intergenic
1158913442 18:62093791-62093813 ACCCTCCAGGTCATCCAAAATGG + Intronic
1159905542 18:74087396-74087418 TACCACCAGGTCCTACTTGAGGG - Intronic
1162577799 19:11508984-11509006 TCCCACCCTGTCCTCCACAGAGG - Intronic
1163023762 19:14497473-14497495 TCCCACCAGGACCTGCAGAGGGG + Intergenic
1164280606 19:23765211-23765233 TCCCACCATGTCTTCCATAATGG - Intronic
1165026842 19:32968587-32968609 GTCCAGCAGGTCCTCCAAAAAGG + Intronic
1165049606 19:33132912-33132934 TCCCACCTGGGCCTCCCAAAGGG - Intronic
1167578668 19:50329621-50329643 CCCCACCAGGTCCTGCCTAGCGG - Intronic
1167956482 19:53069104-53069126 ACCCATCAGGTCATCCATACTGG - Exonic
1167961538 19:53108570-53108592 ACCCATCAGGTCATCCATACTGG - Exonic
1167961547 19:53108654-53108676 ACCCATCAGGTCATCCATACTGG - Exonic
1167965392 19:53140882-53140904 ACCCATCAGGTCATCCATACTGG - Exonic
1167965416 19:53141134-53141156 ACCCATCAGGTCATCCATACTGG - Exonic
1167965430 19:53141302-53141324 ACCCATCAGGTCATCCATACTGG - Exonic
1167968097 19:53164709-53164731 ACCCATCAGGTCATCCATACTGG - Exonic
926161050 2:10489538-10489560 TCCCACCAGCTCCAAAATAAAGG - Intergenic
927642852 2:24856484-24856506 CCCCACCAGGGCGTCCATCATGG + Intronic
928633047 2:33213947-33213969 TCTCAACAGGGCCTCCAGAAAGG - Intronic
930653902 2:53989568-53989590 TCCCACCAAGACCTAGATAATGG - Intronic
935386873 2:102509177-102509199 TCTCCCCAGGGCCTCCAGAAAGG - Intronic
936418445 2:112341654-112341676 TCCTTCCACGTCTTCCATAAAGG + Intergenic
936956409 2:118026909-118026931 TCCCACCTGAGCCTCCAAAAGGG - Intergenic
938480331 2:131657567-131657589 TCCCACCATGCCCTACATTATGG - Intergenic
938573569 2:132584213-132584235 TGCCCCCAGAGCCTCCATAAAGG - Intronic
938876810 2:135540291-135540313 CCCCTCCAAGTCATCCATAAAGG + Intronic
940073598 2:149716860-149716882 TCCCACCAGGTCCTCTAAGTTGG - Intergenic
942704703 2:178757380-178757402 TCCCGCTAGGTCCTCAATTATGG - Intronic
942929704 2:181474964-181474986 TTCCACAAGGTTCTCCATTAGGG - Exonic
943267228 2:185748385-185748407 TCCCACCTTGTCCTCCTGAAGGG + Intronic
947796662 2:232897344-232897366 TCCTCCCAGGTCCCCCAGAAAGG + Intronic
948008022 2:234626761-234626783 TTCCACCAGGTGCACCATGAGGG + Intergenic
948866109 2:240775672-240775694 TTGCCCCAGGTCCTCCAGAAGGG + Intronic
949065482 2:241987797-241987819 TCGCCCCAGGTGCTCCAGAAAGG + Intergenic
1176424265 21:6538300-6538322 TCCCAGCAGGCCCTCAAGAAGGG + Intergenic
1178896735 21:36564946-36564968 TTCCCCCAGGGCCTCCAGAAAGG + Intronic
1179699758 21:43146615-43146637 TCCCAGCAGGCCCTCAAGAAGGG + Intergenic
1180077358 21:45469461-45469483 TCCCACCACGTGCTCCAAAGTGG - Intronic
1180331963 22:11489477-11489499 TCCCACCAGTCCCTCCATTCGGG + Intergenic
1181718786 22:24757364-24757386 TCCCACCTGGGCCTCCCAAAGGG - Intronic
1182705545 22:32276688-32276710 ACCCTCCAGGTCATCCAAAATGG + Intergenic
1184304480 22:43587202-43587224 TACCTCCAGGTCTTCCATTAGGG - Intronic
951528336 3:23675081-23675103 TCCCACCATGGCCTCCCAAAGGG + Intergenic
954291330 3:49651532-49651554 GCCCACCAGGTCCTGCAGCAGGG - Exonic
955121218 3:56060565-56060587 ACCCAACAGGTGCTTCATAAAGG + Intronic
955402847 3:58605671-58605693 TGGCACCAGGTCCTCTATCATGG + Intronic
956049231 3:65229788-65229810 TCCCTTCAGTTCCTCCACAAAGG + Intergenic
958216323 3:90583874-90583896 TCCTACGAAGTCCTCCAAAAAGG + Intergenic
963633813 3:147768084-147768106 TCCCACCAGGCCCTGCATTGGGG - Intergenic
965636595 3:170788327-170788349 TCCCCCGAGGGCCTCCAGAAAGG + Intronic
966207490 3:177419980-177420002 TCCCACCCTGGCCTCCATGAAGG + Intergenic
967639390 3:191842987-191843009 TCTTTCCAAGTCCTCCATAAGGG + Intergenic
968359781 3:198138820-198138842 GCCCACCTGCTCCTCCCTAATGG - Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
978468330 4:109033020-109033042 TCCCACCAGGTCCTCCATAAAGG + Intronic
980439097 4:132817684-132817706 TCCCACCAGTTCCTCCTCTAGGG - Intergenic
984840628 4:184064318-184064340 TCCCACCTTGGCCTCCAAAAGGG + Intergenic
985990612 5:3557455-3557477 TCCCACAAGGGACTCCATGAGGG - Intergenic
989035579 5:37168160-37168182 ACCCACCAAGTCCTCTTTAAAGG - Intronic
990178640 5:53135668-53135690 TCCCACCAGGACATCAAAAATGG + Intergenic
990722853 5:58717498-58717520 TCCCTGAAGGTCCTCCATAAGGG - Intronic
992326825 5:75668187-75668209 ACACTCCAGGCCCTCCATAAAGG - Intronic
993047854 5:82888739-82888761 TGCCACCAGCACCTCCAGAATGG - Intergenic
993720107 5:91313856-91313878 TCCCCCCAGTTCCTCCCAAATGG + Intergenic
995857535 5:116609091-116609113 TCCCACCAGGTCTCACATGAAGG + Intergenic
996479538 5:123959221-123959243 TCCCCCCGGGACCTACATAAGGG - Intergenic
996579476 5:125015351-125015373 TACCCCCAGGTACTCCAGAAGGG + Intergenic
998483381 5:142481256-142481278 TCTCACCAGTTCCTCCAGCACGG + Intergenic
999366087 5:151024414-151024436 TCCAACCAGGTCAACCATGATGG - Intronic
999847597 5:155501828-155501850 TACCATCAGGTCCTCACTAAAGG + Intergenic
1001435023 5:171693450-171693472 TCCCACCAGTGCCCCCATACAGG - Intergenic
1003585455 6:7384823-7384845 TCCCACCCAGGCCTCCAAAATGG + Intronic
1003957372 6:11176405-11176427 TCTCACCAGGGTCTTCATAACGG - Intergenic
1011360217 6:86515964-86515986 ACCCACCAGGTCATCCTTGAAGG + Intergenic
1012207746 6:96481815-96481837 CCCCACAAAGTCATCCATAAAGG + Intergenic
1013811366 6:114048567-114048589 TTCCCCCAGGGCCTCCAGAAGGG - Intergenic
1014054746 6:117000823-117000845 TTCCACCTAGTCATCCATAAAGG - Intergenic
1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG + Intronic
1019260207 7:77830-77852 GCCCACCTGCTCCTCCCTAATGG + Intergenic
1019551100 7:1602978-1603000 TCCCACCATGGCCTCCCAAAGGG - Intergenic
1023370633 7:39509064-39509086 TCCCACCAGGCCCTGCACACCGG + Intergenic
1026256022 7:68712094-68712116 ACCCTCCAGGTCATCCACAAGGG + Intergenic
1027623417 7:80520570-80520592 TTCCACCAGGTGCACAATAAGGG - Intronic
1029416011 7:100443614-100443636 TCCCACCTGGGCCTCCCAAAGGG - Intergenic
1033491541 7:141848262-141848284 TCCAACCATGTCCTCCAGCATGG + Intergenic
1035141542 7:156767257-156767279 TCCTACCTGGTCCTTCACAAAGG + Intronic
1037977046 8:23221100-23221122 TCCCACCTGCACCTCCATACTGG - Intronic
1041254598 8:55969033-55969055 TCCCACCTTGGCCTCCAAAAGGG - Intronic
1042575093 8:70209129-70209151 TCCCTCCAAGTCATCCATGAGGG - Intronic
1043798231 8:84573355-84573377 TCCTATCAGGTCCTCCAAAATGG + Intronic
1044394435 8:91693383-91693405 TGCCACATGGTCTTCCATAATGG + Intergenic
1046405064 8:113762708-113762730 TCCCACCAGTTCATCCCTGATGG + Intergenic
1049529765 8:143148377-143148399 TCCCACCAGGACCTCCCAGATGG + Intergenic
1051682953 9:19626518-19626540 TTCCACCAAGTCCTGCAAAATGG + Intronic
1052140760 9:24979893-24979915 TCCCACCAAAACCTCAATAAAGG - Intergenic
1053229267 9:36392489-36392511 TCTCACCAGGGCCTCCCAAAGGG - Intronic
1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG + Intronic
1055854095 9:80665119-80665141 TCCCACTAGGTCTTTCATGAAGG - Intergenic
1057984592 9:99699140-99699162 GCCCTCCAGGTCATCCATAAAGG - Intergenic
1061148609 9:128816017-128816039 TCCCACCTTGGCCTCCAAAAGGG + Intergenic
1061678857 9:132232711-132232733 CCCCACCAGGTCCTCCCTGCAGG - Intronic
1061875437 9:133541197-133541219 ACCCAGCAGGTCCTCAACAAAGG - Intronic
1062744484 9:138202641-138202663 GCCCACCTGCTCCTCCCTAATGG - Intergenic
1186509423 X:10119312-10119334 TCCCACCACCTTCTCCTTAAGGG + Intronic
1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG + Intergenic
1189741357 X:44120213-44120235 TCGCCCCAGGTTCTCCAAAAAGG + Intergenic
1192264840 X:69531039-69531061 TGCCACCAGGTTCTCCTTCATGG - Exonic
1193652091 X:84149259-84149281 CCCCTCCAAGTCATCCATAAGGG + Intronic
1194931962 X:99900002-99900024 ACCCTCCAGGTCCTGCTTAAAGG + Intergenic
1195198745 X:102525516-102525538 TACCACCACGTCTTCCACAATGG - Intergenic
1196061808 X:111416405-111416427 TCCCACCAGGTCCAGCATTGGGG - Intergenic
1199189166 X:144950590-144950612 TAGTACCAGGTCCACCATAATGG + Intergenic
1199590111 X:149459795-149459817 TTCCTCCAGGTCCACCAGAAAGG - Intergenic
1201681884 Y:16655193-16655215 TGCCACTCGGTCTTCCATAATGG + Intergenic