ID: 978470200

View in Genome Browser
Species Human (GRCh38)
Location 4:109057507-109057529
Sequence CCGGCAGGTCACCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72512
Summary {0: 2, 1: 29, 2: 1273, 3: 19008, 4: 52200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978470200_978470211 27 Left 978470200 4:109057507-109057529 CCTGACTTCAGGTGACCTGCCGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200
Right 978470211 4:109057557-109057579 TAGGCATGAGCCACTGTGCCTGG 0: 1019
1: 11106
2: 38506
3: 89411
4: 145334
978470200_978470206 0 Left 978470200 4:109057507-109057529 CCTGACTTCAGGTGACCTGCCGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200
Right 978470206 4:109057530-109057552 CCTTTGCCTCCCAAAGTGCTGGG 0: 681
1: 95119
2: 308670
3: 223023
4: 122058
978470200_978470204 -1 Left 978470200 4:109057507-109057529 CCTGACTTCAGGTGACCTGCCGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200
Right 978470204 4:109057529-109057551 GCCTTTGCCTCCCAAAGTGCTGG 0: 392
1: 59777
2: 230663
3: 240054
4: 156397
978470200_978470208 8 Left 978470200 4:109057507-109057529 CCTGACTTCAGGTGACCTGCCGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200
Right 978470208 4:109057538-109057560 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978470200 Original CRISPR CCGGCAGGTCACCTGAAGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr