ID: 978476007

View in Genome Browser
Species Human (GRCh38)
Location 4:109131153-109131175
Sequence CTCATCAGTAATGTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978476005_978476007 26 Left 978476005 4:109131104-109131126 CCTTATATGACAAAGAACTCTAA 0: 1
1: 1
2: 2
3: 19
4: 299
Right 978476007 4:109131153-109131175 CTCATCAGTAATGTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978476007 Original CRISPR CTCATCAGTAATGTTTTTGT TGG Intronic
No off target data available for this crispr