ID: 978476540

View in Genome Browser
Species Human (GRCh38)
Location 4:109137541-109137563
Sequence TCATTTCCCCACCTAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978476535_978476540 -2 Left 978476535 4:109137520-109137542 CCACTGGCAACAACCCCCTAATC 0: 1
1: 0
2: 2
3: 10
4: 168
Right 978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144
978476531_978476540 20 Left 978476531 4:109137498-109137520 CCTCTATCATCTCCAACCTGGAC 0: 1
1: 0
2: 22
3: 61
4: 393
Right 978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144
978476534_978476540 4 Left 978476534 4:109137514-109137536 CCTGGACCACTGGCAACAACCCC 0: 1
1: 0
2: 1
3: 28
4: 203
Right 978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144
978476533_978476540 8 Left 978476533 4:109137510-109137532 CCAACCTGGACCACTGGCAACAA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978476540 Original CRISPR TCATTTCCCCACCTAGAGTC TGG Intronic
900748486 1:4377708-4377730 TCATTTTCCCAAGTGGAGTCAGG + Intergenic
902265032 1:15257236-15257258 TCAGTTCCCCACCAACAGTGAGG + Intronic
903183195 1:21615299-21615321 CCATTACCCCACCTGGAGTCAGG + Intronic
904033128 1:27545507-27545529 CCATTTTCCCACCCAGAGCCTGG + Intronic
905491994 1:38351693-38351715 TAATTTCCTCCCCTTGAGTCTGG - Intergenic
906800598 1:48733855-48733877 TCATTTCCAAACATAGTGTCTGG - Intronic
913970945 1:143417242-143417264 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
914065323 1:144242853-144242875 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
914113828 1:144723501-144723523 TCTCTTCCCCAGCTTGAGTCTGG + Intergenic
914843190 1:151265108-151265130 TCCTTTCCCCCCCTCGAGTATGG + Intronic
914915544 1:151816966-151816988 TCATTTCCCCAGCTTAAGACAGG + Intronic
914952984 1:152133515-152133537 TCATTTCCCTACCCAGATTTGGG - Intergenic
915715356 1:157940036-157940058 TCATTTCCCTCCCTAGAGTAGGG + Intergenic
916123878 1:161551933-161551955 TTTTTTCCCCCCCAAGAGTCAGG - Intergenic
916133762 1:161633296-161633318 TTTTTTCCCCCCCAAGAGTCAGG - Intronic
917657567 1:177141764-177141786 TCTTTTCTCCACCTAGCTTCAGG - Intronic
918711207 1:187732580-187732602 TCACTTAGCCACCTAGTGTCAGG - Intergenic
921862960 1:220058263-220058285 TCATTTCTCCACCTAAATACAGG + Exonic
921991181 1:221369756-221369778 TCCCTTCCCCACCTAGATTCAGG - Intergenic
923011893 1:230094858-230094880 TGATCTCCCCACGTAGAGACAGG + Intronic
923671788 1:236047626-236047648 TTGTCTCCCCAACTAGAGTCTGG + Intronic
1066243775 10:33562345-33562367 TAAATTCCCCACTGAGAGTCAGG - Intergenic
1070908990 10:80100946-80100968 TAATTTCCCCACTTAGTGTTAGG - Intergenic
1070975074 10:80599943-80599965 TCACTTCCCCACCTCCACTCAGG + Intronic
1073350429 10:102815778-102815800 TCCTTTCCCCAGTTAGAGTGGGG + Exonic
1074796321 10:116948735-116948757 TTATTACCCAACTTAGAGTCTGG - Intronic
1077452571 11:2658055-2658077 TCCCTTCCCCACCTTGAGTGTGG - Intronic
1081704117 11:45170736-45170758 TCCATTCCCCACCCACAGTCAGG - Intronic
1082761418 11:57130598-57130620 TCTTTTCCACACCTTGATTCTGG - Intergenic
1083773663 11:64882476-64882498 TCAGTTCCTCACCTTGTGTCGGG - Intronic
1083970647 11:66071849-66071871 TCCTTTCCCCACCTTTATTCTGG + Intronic
1084941451 11:72615443-72615465 TCAGTCCCTCACCCAGAGTCTGG + Intronic
1087181071 11:95143256-95143278 GCATTTCCCCAGATCGAGTCAGG + Intergenic
1090030461 11:123201741-123201763 TCAATTCCCCACCTAAAGGAAGG - Intergenic
1090518637 11:127455247-127455269 CCATTTCCCCACCTGGATCCAGG - Intergenic
1091394896 12:148095-148117 TCATTTCCTCACCTTGAGAATGG - Intronic
1092655671 12:10682238-10682260 TCATTTCCCTACCTACTGGCTGG + Intergenic
1095404323 12:41851158-41851180 CAATTTCCCCACCTGGAGTCTGG - Intergenic
1096855980 12:54483315-54483337 TCATTTGCCAACCAAAAGTCTGG - Intergenic
1099742150 12:86652519-86652541 TTATTTGCCCAGCTAGAATCAGG - Intronic
1102798558 12:115711174-115711196 TCAATTACCCAATTAGAGTCTGG + Intergenic
1108249906 13:48553965-48553987 TCATTTCCCCACTTAGAACCAGG - Intergenic
1108317427 13:49250444-49250466 TCACTTCCCCATATAGAGCCTGG - Intronic
1110522087 13:76491589-76491611 TCCCTTCCCCACCTAGAGGCAGG + Intergenic
1111344532 13:86933320-86933342 TCCTTTCCCCAGTTAGAGTGGGG - Intergenic
1117094043 14:52279539-52279561 GCTTTCCTCCACCTAGAGTCTGG - Intergenic
1119894816 14:78211247-78211269 TCCTGTCACCTCCTAGAGTCTGG + Intergenic
1122038560 14:98965608-98965630 TCATTTCTCCACCTAGCTCCTGG + Intergenic
1123393425 15:19900001-19900023 ACATTACACCACCTTGAGTCTGG + Intergenic
1125584946 15:40813463-40813485 TCATTGCCCCACCTCTACTCTGG + Intronic
1132650284 16:1018461-1018483 TCACTCCCCCAGCTAGAGTGCGG + Intergenic
1134793537 16:17013213-17013235 TCATTCCTTCACCTAGAGTAAGG + Intergenic
1138884540 16:61060248-61060270 TCACTTACCCACCTAGGGTATGG + Intergenic
1141142340 16:81504782-81504804 TCATTTCTCTCCCTAGAGGCTGG - Intronic
1141343974 16:83228475-83228497 TCATTGCCCCAGCTAGCGTGTGG - Intronic
1141646457 16:85370502-85370524 TCCTTTGCCCTCCTAGGGTCTGG - Intergenic
1143204498 17:5132662-5132684 TCAGGACCCCACCTAGAGGCTGG + Intronic
1145760224 17:27421375-27421397 TCAGGACCCCACCTAGAGACTGG + Intergenic
1146054396 17:29573942-29573964 TCCCTTCCCCACCTGGAGCCAGG - Exonic
1146844161 17:36173151-36173173 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146856466 17:36261086-36261108 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146864151 17:36327289-36327311 TCAGGACCCCACCTAGAGGCTGG + Intronic
1146872376 17:36384997-36385019 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146879734 17:36436082-36436104 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146883659 17:36457234-36457256 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1147067011 17:37927877-37927899 TCAGGACCCCACCTAGAGGCTGG + Intronic
1147075260 17:37985621-37985643 TCAGGACCCCACCTAGAGGCTGG - Intronic
1147078543 17:38007438-38007460 TCAGGACCCCACCTAGAGGCTGG + Intronic
1147086785 17:38065167-38065189 TCAGGACCCCACCTAGAGGCTGG - Intronic
1147094481 17:38131373-38131395 TCAGGACCCCACCTAGAGGCTGG + Intergenic
1147102730 17:38189130-38189152 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1150085662 17:62272214-62272236 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1153042812 18:829920-829942 TCATTTCATCACCTTGAGACAGG - Intergenic
1156751225 18:40458121-40458143 TCATTTCCCCACTAAGAGAAAGG - Intergenic
1158491116 18:57910593-57910615 TCATTTACTGACCTAGAATCAGG - Intergenic
1162812013 19:13169975-13169997 TCATATCCCAACCTTGAGCCTGG + Intergenic
1165745858 19:38229275-38229297 CCGTTTCCCCACCCAGAGTGGGG - Intronic
1166989859 19:46685640-46685662 TCCTTTCCACACCTGAAGTCTGG + Intronic
1168432341 19:56291241-56291263 TCATTTCTCCCCCGAGGGTCAGG - Intronic
925528601 2:4833873-4833895 TAATTTTCCCACCTTGAATCTGG + Intergenic
929857090 2:45646621-45646643 TCATCTCCCCAGGTAGAGTAGGG + Intergenic
932015956 2:68026631-68026653 TCTTTTCCCCACTTTGAGTTGGG - Intergenic
934175644 2:89578165-89578187 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
934285960 2:91652530-91652552 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
935329233 2:101964358-101964380 TCATTTCCCTGCTTAGAGGCTGG - Intergenic
935686960 2:105692405-105692427 TCATTTCCACACCCAGGATCTGG - Intergenic
944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG + Intergenic
945674628 2:212841150-212841172 TCCTTTCCCCAGCTATAGTGTGG + Intergenic
1169321736 20:4638338-4638360 TTCTTTTCCCACTTAGAGTCAGG - Intergenic
1172317540 20:33967875-33967897 TCACTTCCCCACATAGAATGTGG + Intergenic
1172501536 20:35431674-35431696 GCATTTTCCCACCCAGACTCTGG - Intergenic
1173134040 20:40423600-40423622 TTATTTCTCAGCCTAGAGTCAGG - Intergenic
1174042870 20:47712506-47712528 TCATTTCCCCAACTAGGGTGTGG + Intronic
1174765535 20:53250092-53250114 CCATTTCCCCAGCTTGACTCTGG - Intronic
1174906221 20:54554524-54554546 TCATTGCCCATCCTAGAATCTGG - Intronic
1179174760 21:39000429-39000451 CCATTTCCCCACCCTGAGACAGG + Intergenic
1179774002 21:43647989-43648011 TGATTTCCCAAACCAGAGTCAGG + Intronic
1180240533 21:46501423-46501445 TTATTTTTCCACCTAGAGACAGG + Intronic
1182572682 22:31250525-31250547 CCGTTTGCCCAGCTAGAGTCTGG + Intronic
1183295552 22:37027324-37027346 TCACTGCCCCACCTTGAGGCAGG - Intronic
1183493740 22:38130063-38130085 ACATTTCCACACCTGGAGGCCGG + Intronic
1184251263 22:43261665-43261687 TCATTTCCACAGCTAGGGTGAGG + Intronic
1184678430 22:46055944-46055966 CCACTTCCCCACCCAGAGTAGGG + Intronic
1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG + Intergenic
949864471 3:8536098-8536120 TCCTTTTCCCTCCTACAGTCAGG - Intronic
953878371 3:46679132-46679154 TAATCTCCCCACTTAGACTCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955980240 3:64517933-64517955 TCATGTACCCACCTAGAGTCAGG - Intronic
957652192 3:83022323-83022345 ACATTTTCCCAACTAGAGTACGG + Intergenic
969244344 4:5922762-5922784 TCCTTTCCCACCCTAGAGTCTGG - Intronic
969615945 4:8252626-8252648 TCATTGCCCCATCAAGAGGCAGG - Intergenic
971572745 4:28234179-28234201 TCATCCCCCCACCCAAAGTCAGG + Intergenic
976600031 4:86929571-86929593 TCATTTCCTCTCCTTGAGTGTGG - Intronic
978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG + Intronic
979116043 4:116825663-116825685 TAATTTCCTCACCTATATTCTGG - Intergenic
985784036 5:1885041-1885063 TCCTTTCCTCACCTATACTCGGG + Intronic
986839999 5:11685802-11685824 TCATTTCCTCACCTCTAGACTGG - Intronic
992100237 5:73400726-73400748 TCATGTACCCACCATGAGTCTGG - Intergenic
992392006 5:76338106-76338128 TCATTTCTCCACCTGGTGTCTGG - Intronic
992914884 5:81439137-81439159 TCACTTCCCGACCTAAGGTCAGG - Intronic
993521667 5:88910315-88910337 TCCTTTCCCAACCTGGAATCAGG + Intergenic
994286966 5:97980850-97980872 TCATTTCCCTATTTAGAGTCTGG + Intergenic
996001290 5:118367518-118367540 TTATATCCCCACATAGAGTGGGG + Intergenic
996103351 5:119469358-119469380 TTATTTATCCACCTAGAGACAGG + Intronic
997696745 5:135866872-135866894 TCATTTCCCCAACTTCAGTTAGG - Intronic
1003569090 6:7244399-7244421 TAATTTCCCTCCCTAGAGTCAGG - Intronic
1005751666 6:28888641-28888663 TCATTTCCCATCTAAGAGTCGGG + Intergenic
1008545445 6:52579239-52579261 TCGTTCCCCCACCTTGAGTGTGG + Intergenic
1010820806 6:80413038-80413060 TCATTTCCCTACCCAGATTTTGG + Intergenic
1013580659 6:111531022-111531044 TCAGTGCCCCACCTGGGGTCTGG + Intergenic
1015413525 6:132921821-132921843 TCATTACCCTTCCTAGACTCTGG + Intergenic
1021150629 7:17146847-17146869 TCATTCTCCCACGTAGTGTCTGG + Intergenic
1021554787 7:21908351-21908373 TCAGTTCCCCACCAAGAAGCTGG - Exonic
1025482034 7:60993358-60993380 ACATTACACCACCTTGAGTCTGG + Intergenic
1025840550 7:65141861-65141883 TCATTATACCACCTTGAGTCTGG + Intergenic
1025878165 7:65508303-65508325 TCATTATACCACCTTGAGTCTGG - Intergenic
1025882502 7:65554098-65554120 TCATTATACCACCTTGAGTCTGG - Intergenic
1025890941 7:65648505-65648527 TCATTATACCACCTTGAGTCTGG + Intergenic
1026385092 7:69838904-69838926 TCATATCCCTAACTAGAGCCAGG - Intronic
1027268993 7:76510226-76510248 TTCTGTCCCCACCCAGAGTCAGG - Intergenic
1027617572 7:80442901-80442923 TCAATTCACCACGTAGAGTTAGG + Intronic
1030267122 7:107632002-107632024 TCCTTTCCCCAGTTAGAGTGGGG + Intergenic
1032286418 7:130541239-130541261 TCACTCCTCCACCTTGAGTCTGG - Intronic
1033052471 7:138018560-138018582 TGTTTTTCCCACCTAGAATCTGG + Intronic
1035070289 7:156139784-156139806 TCATGTCCCCACCCAGAGGGAGG + Intergenic
1036672279 8:10799383-10799405 TCATTTCCCCAGCAACTGTCAGG - Intronic
1039136920 8:34335393-34335415 ACATCTCTCCACCTAGAGGCAGG - Intergenic
1039889120 8:41672376-41672398 ACATTCCCCCACCGTGAGTCAGG - Exonic
1039947910 8:42145839-42145861 TTTTTTCCCCGCTTAGAGTCAGG - Intergenic
1042183673 8:66115977-66115999 ACATTTCAGCACCTAGAGGCCGG + Intergenic
1044351028 8:91166934-91166956 TCTTTTCCCCACCTACACTCCGG + Intronic
1044603696 8:94031027-94031049 TCTGTTCCCCACCTTGTGTCAGG + Intergenic
1044751549 8:95421309-95421331 ACTTTTCCCCAACCAGAGTCAGG - Intergenic
1053316415 9:37055594-37055616 TCATTTCCCCACCTATAGAATGG + Intergenic
1053321407 9:37101962-37101984 TCATTTCCCCACCTATAGAATGG + Intergenic
1053437157 9:38083545-38083567 TCATTTGCACACTTTGAGTCAGG + Intergenic
1059759005 9:117320741-117320763 TGATTTCCTTACCTACAGTCAGG + Intronic
1060553774 9:124498117-124498139 TCATTTCCCCACCTCCAGACAGG - Intronic
1189168606 X:38886833-38886855 TCACTTCCCCCCATAGTGTCTGG - Intergenic
1189781163 X:44515679-44515701 TCCTGTCCCCACCTTCAGTCTGG - Intergenic
1192198088 X:69045790-69045812 TCATTGTCACACCTGGAGTCTGG - Intergenic