ID: 978477224

View in Genome Browser
Species Human (GRCh38)
Location 4:109144541-109144563
Sequence TCATCTATAAGCCCCTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978477214_978477224 17 Left 978477214 4:109144501-109144523 CCCCTTCCCCCAGGTGTTCTGTG 0: 1
1: 35
2: 628
3: 717
4: 823
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477219_978477224 10 Left 978477219 4:109144508-109144530 CCCCAGGTGTTCTGTGCAAGGAA 0: 1
1: 0
2: 3
3: 124
4: 1007
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477218_978477224 11 Left 978477218 4:109144507-109144529 CCCCCAGGTGTTCTGTGCAAGGA 0: 1
1: 0
2: 3
3: 109
4: 844
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477216_978477224 15 Left 978477216 4:109144503-109144525 CCTTCCCCCAGGTGTTCTGTGCA 0: 1
1: 0
2: 48
3: 672
4: 1027
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477215_978477224 16 Left 978477215 4:109144502-109144524 CCCTTCCCCCAGGTGTTCTGTGC 0: 1
1: 37
2: 640
3: 710
4: 698
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477210_978477224 27 Left 978477210 4:109144491-109144513 CCCACAGCCGCCCCTTCCCCCAG No data
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477221_978477224 8 Left 978477221 4:109144510-109144532 CCAGGTGTTCTGTGCAAGGAAGA No data
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477213_978477224 20 Left 978477213 4:109144498-109144520 CCGCCCCTTCCCCCAGGTGTTCT 0: 16
1: 355
2: 411
3: 317
4: 719
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477211_978477224 26 Left 978477211 4:109144492-109144514 CCACAGCCGCCCCTTCCCCCAGG 0: 127
1: 506
2: 613
3: 533
4: 1182
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data
978477220_978477224 9 Left 978477220 4:109144509-109144531 CCCAGGTGTTCTGTGCAAGGAAG 0: 1
1: 0
2: 4
3: 128
4: 1014
Right 978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978477224 Original CRISPR TCATCTATAAGCCCCTGACT AGG Intronic