ID: 978482151

View in Genome Browser
Species Human (GRCh38)
Location 4:109205427-109205449
Sequence GTGGACAGACATTGACATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978482140_978482151 30 Left 978482140 4:109205374-109205396 CCAGCCTCCCTGAAGCTGGATGC 0: 1
1: 0
2: 1
3: 28
4: 299
Right 978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG 0: 1
1: 0
2: 1
3: 14
4: 108
978482142_978482151 26 Left 978482142 4:109205378-109205400 CCTCCCTGAAGCTGGATGCGGAC 0: 1
1: 0
2: 2
3: 7
4: 189
Right 978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG 0: 1
1: 0
2: 1
3: 14
4: 108
978482143_978482151 23 Left 978482143 4:109205381-109205403 CCCTGAAGCTGGATGCGGACACG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG 0: 1
1: 0
2: 1
3: 14
4: 108
978482144_978482151 22 Left 978482144 4:109205382-109205404 CCTGAAGCTGGATGCGGACACGG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG 0: 1
1: 0
2: 1
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978482151 Original CRISPR GTGGACAGACATTGACATAT AGG Intronic
904915946 1:33970718-33970740 GTGGACACATATGGACATAGGGG - Intronic
905347652 1:37322186-37322208 GTGCACAAAGTTTGACATATAGG - Intergenic
917960602 1:180141390-180141412 GTGTAAAGACACTGTCATATGGG - Intergenic
922409637 1:225359324-225359346 GTGCATAGACATAGACATAAGGG - Intronic
1066062272 10:31734842-31734864 GTCCACAGTCATTGTCATATGGG - Intergenic
1072348259 10:94530280-94530302 GTGGTCAGACATTGTCAGAAAGG + Intronic
1074380664 10:112977448-112977470 GGGAGCAGACATTGACATACGGG + Intronic
1078722726 11:13898898-13898920 GTGAACAGAAATTCACATAAGGG - Intergenic
1078832529 11:14991391-14991413 GTGGACACACTTTGCGATATGGG - Intronic
1079073512 11:17368386-17368408 GTGGTCAGGCAATGCCATATGGG + Intronic
1079270606 11:18982375-18982397 AGGGACAGACATGGACAGATAGG + Intergenic
1079372829 11:19866329-19866351 GCTGCCAGACATTGACAAATTGG + Intronic
1083013746 11:59429291-59429313 ATGGACAGATATTAACAGATGGG - Intergenic
1084284868 11:68124547-68124569 GTGCACAGACATTGACATTTTGG - Intergenic
1084773449 11:71359063-71359085 ATAGACAGATATTGAGATATTGG - Intergenic
1087688100 11:101287951-101287973 GTGGACATACATTTTCATTTGGG + Intergenic
1088564582 11:111155304-111155326 ATGAACAGACACAGACATATGGG - Intergenic
1091111731 11:132975714-132975736 GTGGACAGATCTTGGCATAGGGG - Intronic
1093121918 12:15280694-15280716 GTGTATATACATTTACATATGGG + Intronic
1095533308 12:43216641-43216663 CTGTACAGACATTCACATATGGG - Intergenic
1098349561 12:69544006-69544028 GTGGACAAAAAATGACAAATGGG + Intronic
1100562755 12:95765427-95765449 TTGGACAGACATTGAGTTAGAGG - Intronic
1101087697 12:101253316-101253338 GTGGATGGGCATTGACATTTAGG + Intergenic
1107285201 13:38782624-38782646 TTGGCCAGCCATTGACAAATAGG + Intronic
1108978847 13:56484040-56484062 GGGGACAGAAATGGACATACAGG - Intergenic
1110052976 13:70927271-70927293 GAGCACAGACATTGATATATGGG + Intergenic
1110499546 13:76210697-76210719 GACCACAGACATTGAAATATTGG - Intergenic
1112963566 13:105159215-105159237 CTGGAAAGACATTGACATTTGGG - Intergenic
1114179261 14:20351542-20351564 GTGAAAAGACATTAACATTTAGG - Intronic
1118481656 14:66173577-66173599 GTATACAAAAATTGACATATCGG + Intergenic
1120669243 14:87345151-87345173 GTGCACAGACATCAACACATTGG + Intergenic
1120887285 14:89461761-89461783 CTGGACAGACCTTGAAAGATAGG + Intronic
1124015084 15:25866921-25866943 ATAGACAGACATGGACAAATTGG + Intergenic
1126336594 15:47591740-47591762 GTGGATGGAGAATGACATATGGG + Intronic
1127623568 15:60758077-60758099 TTGGGAAGTCATTGACATATAGG - Intronic
1128953367 15:71911675-71911697 GTGACCAGACTTTGACATACAGG + Intronic
1129090920 15:73149429-73149451 CTGGAGATACAATGACATATAGG + Intronic
1130387105 15:83421595-83421617 GTGTACATACAATGAAATATTGG - Intergenic
1131003777 15:88959363-88959385 GTGGACAGATTTTGCCATGTTGG - Intergenic
1131687236 15:94781363-94781385 GAGGACAAATATTGACATCTAGG + Intergenic
1133867533 16:9658105-9658127 GGGGAAAGACATTGACATTAGGG + Intergenic
1141882225 16:86867664-86867686 GTGCACAGACATGAACACATGGG - Intergenic
1144556616 17:16287968-16287990 GGGCACAGATATTCACATATAGG + Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1146193647 17:30792439-30792461 GTGGGCAGACATTAACATTCAGG - Exonic
1146555536 17:33820062-33820084 GTGGACAGTAGTTGCCATATTGG - Intronic
1146706460 17:35004034-35004056 GTGGACAGGCCTCGACATCTGGG - Intronic
1146950363 17:36901133-36901155 GTGTACAGACATTCACATGTTGG - Intergenic
1150521335 17:65869538-65869560 GAGGACAGAACTTAACATATAGG + Intronic
1150602427 17:66662310-66662332 GTGCACAGACCTTGACTCATGGG + Intronic
1156974672 18:43205466-43205488 GTGGACAGATATTTTCATTTGGG + Intergenic
1158751769 18:60270298-60270320 GTGGATACACATGGACATAAAGG - Intergenic
1160755088 19:752782-752804 GTGGACAGACGTTTACACAGCGG - Intronic
1163628948 19:18406879-18406901 GTGGACTGACATGGACATTGTGG + Intergenic
1165123897 19:33580738-33580760 CTGGACAGACAGAGACATGTGGG - Intergenic
1167108749 19:47446888-47446910 GTAGACAGACGTTTACAGATTGG - Intronic
1168487641 19:56778091-56778113 GTGGATAGAGAATGAGATATGGG - Intronic
1168506564 19:56940046-56940068 GAGGACAGACAATGTCATCTGGG + Intergenic
925636648 2:5947583-5947605 GTAGACAGACAGTGACACACCGG + Intergenic
929213888 2:39390151-39390173 GTGGAGGGACATTTACATTTTGG + Intronic
931182858 2:59920580-59920602 TTAGACAGAGATTTACATATGGG - Intergenic
937590261 2:123605030-123605052 GTGGACACACATGGGCAGATAGG - Intergenic
942516112 2:176755103-176755125 GTGAACATTCATTGACATCTCGG - Intergenic
944231533 2:197398858-197398880 GTGCACTGACATTTAAATATGGG + Intronic
945840149 2:214878246-214878268 GTGGTCAGAATTTGACATTTAGG + Intergenic
948416989 2:237815301-237815323 CTGGACAGACATTCACATCTGGG + Intronic
948509764 2:238455983-238456005 GGGGACAGGCAGTGACAAATGGG + Intergenic
1169743599 20:8920615-8920637 GTGGAGAGAGAATGAGATATTGG + Intronic
1178809940 21:35872382-35872404 GGGGACACACAGTGACACATGGG - Intronic
1179392451 21:41006323-41006345 GTGCACAGACATCCACATATAGG - Intergenic
1183441977 22:37828326-37828348 GTGGGGAGACATGGACAGATGGG + Intergenic
1184707006 22:46221473-46221495 GTGAAAAGACAGTGACATCTTGG + Intronic
949635075 3:5973825-5973847 GTGGACTGACACTCATATATTGG + Intergenic
950114482 3:10441747-10441769 GTGGACACACATTTATTTATTGG - Intronic
955153933 3:56397058-56397080 GTGTACAGACATTGTCCTTTGGG - Intronic
963320120 3:143802143-143802165 GTGGAAAGAGATTGACAGGTGGG - Intronic
964310578 3:155387324-155387346 GAAAACAGACATTGAAATATAGG - Intronic
965141116 3:164835947-164835969 GTGGACAGATTCTCACATATGGG - Intergenic
967770771 3:193331318-193331340 GAGGACAGACATTTTCATACAGG + Intronic
970453565 4:16197952-16197974 GAGGACAGACATTAACTTTTAGG + Intronic
971573000 4:28237423-28237445 TTAGACAGACAGTAACATATGGG - Intergenic
978067574 4:104424503-104424525 GTGGACACACTTTGACAGAAGGG - Intergenic
978424667 4:108569754-108569776 GTGAACCTACATTGACATATCGG - Intergenic
978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG + Intronic
981728931 4:147877098-147877120 GTGGAAAGACCTTGATATTTGGG + Intronic
982375751 4:154688875-154688897 TTGGAGAGCCATTGGCATATAGG - Intronic
984883072 4:184427235-184427257 GTGGTAAGACCTTGAGATATGGG + Intronic
985264572 4:188145844-188145866 GTGAACCGACAGTCACATATGGG - Intronic
988067210 5:26236901-26236923 GTGTATAGACATTGAGCTATTGG + Intergenic
991123234 5:63040909-63040931 ATGGAAAGCCATTGACAAATAGG + Intergenic
993564885 5:89461602-89461624 GTGGATATACATGGACATAGAGG + Intergenic
993976241 5:94485662-94485684 GTGGTCAGATATTAACATTTGGG + Intronic
997421179 5:133767935-133767957 GTGGAAAAACATTGACAAAGAGG + Intergenic
998536737 5:142939829-142939851 ATGTACAGGCATTTACATATAGG - Intronic
1001154668 5:169262660-169262682 GTGGAATGAAATTGACATTTGGG - Intronic
1002720685 5:181259840-181259862 GTGGAGAGAGATGGTCATATGGG - Intronic
1003810711 6:9776888-9776910 GGGGATAGACCTTGCCATATGGG - Intronic
1004561398 6:16755049-16755071 GTGCACACACATTGTCATATAGG - Intronic
1009365249 6:62852873-62852895 GTGTACAGCCCTTGAGATATTGG - Intergenic
1013187500 6:107772910-107772932 GTGGACAGAGATTTACATACAGG + Intronic
1015898654 6:138041426-138041448 GGAGACAGACATTGACATCTTGG - Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1023995060 7:45154762-45154784 CTGGACAGACACTGAAATAACGG - Intergenic
1024895761 7:54259717-54259739 CTGGGCTGACATTGACAAATAGG - Intergenic
1029724495 7:102393326-102393348 CTGGACAGACATTCACAGCTGGG - Intronic
1031451007 7:121918241-121918263 ATGGATAGACAGTGACATTTGGG + Intronic
1033619766 7:143051693-143051715 GGCAACAGACATTGACATTTAGG - Intergenic
1035138319 7:156730121-156730143 GAGGACAGACATTGGCATTTGGG + Intronic
1036112813 8:5923362-5923384 GAAGAAAGACATTGACACATTGG + Intergenic
1038923102 8:32107929-32107951 GTAAACAGACATTAACATAGGGG - Intronic
1041223878 8:55678969-55678991 ATGGACAGACAGTCTCATATGGG - Intergenic
1042600279 8:70492845-70492867 GAAGACAGACATTGACAAATAGG - Intergenic
1046530536 8:115439346-115439368 ATGGACAGACATTGAGCTAGTGG + Intronic
1053899345 9:42777815-42777837 TTGAACAGACATTTACATATAGG - Intergenic
1055024015 9:71699996-71700018 GTGCATAGACAATGGCATATAGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1192421728 X:71038226-71038248 GTGGACAGAGAATGAGATATTGG + Intergenic
1196174787 X:112628541-112628563 GTGGAAAGAGAGTGAGATATGGG + Intergenic
1196294281 X:113980740-113980762 ATGGAGAGGCATTGCCATATTGG - Intergenic
1197718814 X:129730664-129730686 GTGGACAAACATAAACAAATAGG + Intergenic