ID: 978482405

View in Genome Browser
Species Human (GRCh38)
Location 4:109208828-109208850
Sequence GTGGAGAATGATCCTCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978482405 Original CRISPR GTGGAGAATGATCCTCTTCA GGG (reversed) Intronic