ID: 978487577

View in Genome Browser
Species Human (GRCh38)
Location 4:109273031-109273053
Sequence TTTTTCATGGGGCATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 258}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978487577_978487589 0 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487589 4:109273054-109273076 TCAACTGGGGAAGGGAGGATGGG 0: 1
1: 0
2: 5
3: 35
4: 371
978487577_978487590 5 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487590 4:109273059-109273081 TGGGGAAGGGAGGATGGGAAAGG 0: 1
1: 1
2: 38
3: 339
4: 2315
978487577_978487593 11 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487593 4:109273065-109273087 AGGGAGGATGGGAAAGGGGAAGG No data
978487577_978487591 6 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487591 4:109273060-109273082 GGGGAAGGGAGGATGGGAAAGGG 0: 1
1: 1
2: 44
3: 449
4: 3107
978487577_978487585 -9 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487585 4:109273045-109273067 CATGAAAAATCAACTGGGGAAGG 0: 1
1: 0
2: 2
3: 44
4: 738
978487577_978487586 -8 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487586 4:109273046-109273068 ATGAAAAATCAACTGGGGAAGGG 0: 1
1: 1
2: 4
3: 52
4: 523
978487577_978487592 7 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487592 4:109273061-109273083 GGGAAGGGAGGATGGGAAAGGGG 0: 1
1: 1
2: 41
3: 541
4: 4593
978487577_978487587 -5 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487587 4:109273049-109273071 AAAAATCAACTGGGGAAGGGAGG No data
978487577_978487594 14 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487594 4:109273068-109273090 GAGGATGGGAAAGGGGAAGGAGG 0: 1
1: 2
2: 45
3: 446
4: 2850
978487577_978487588 -1 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487588 4:109273053-109273075 ATCAACTGGGGAAGGGAGGATGG 0: 1
1: 2
2: 4
3: 62
4: 571
978487577_978487595 15 Left 978487577 4:109273031-109273053 CCCAATATATGCCCCATGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 258
Right 978487595 4:109273069-109273091 AGGATGGGAAAGGGGAAGGAGGG 0: 2
1: 1
2: 75
3: 648
4: 4644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978487577 Original CRISPR TTTTTCATGGGGCATATATT GGG (reversed) Intronic
900007615 1:73509-73531 TTTTCCTTTGGGCATATATGCGG + Intergenic
900759323 1:4460489-4460511 TTTTTCATGGGGTATAAAACAGG + Intergenic
901294396 1:8149290-8149312 ATCTTCATGGGGCATATATTGGG - Intergenic
907294881 1:53444213-53444235 TCTTTCATGGAGCATATTTCGGG + Intergenic
908138934 1:61162639-61162661 TTTTCCATGGGACAGATAGTGGG - Intronic
908774696 1:67628497-67628519 TTTTGCATGGGTCATTTATCTGG - Intergenic
909096851 1:71298036-71298058 TTTTCAATGTGGCATATATCTGG - Intergenic
909294473 1:73929824-73929846 TAATTAAAGGGGCATATATTTGG - Intergenic
910404231 1:86869563-86869585 CTATACATGGGGCATTTATTTGG + Intronic
911546343 1:99222262-99222284 TTTTTGATTGGCCATATAATTGG - Intergenic
912092510 1:106097896-106097918 ATTTTTATGGGGGTTATATTTGG + Intergenic
912830787 1:112952005-112952027 TCCTTCAGGAGGCATATATTTGG - Intronic
915445551 1:155972583-155972605 TTTTTCTTGGTGCATAGGTTGGG - Intronic
915963769 1:160288935-160288957 TTTTTCATAGGGTATATATGAGG - Intergenic
915985352 1:160458923-160458945 TTTCCCATGGGGTATATTTTAGG + Intergenic
916560102 1:165927194-165927216 TTTTCCTTTGGGCATATATCTGG + Intergenic
919109876 1:193205428-193205450 TGGTACATGGGGCTTATATTGGG + Intronic
919273448 1:195381840-195381862 TATTTGATGGGGCCTATTTTTGG - Intergenic
920003355 1:202814356-202814378 TTGTTCATGGGGAATATAGAGGG - Intergenic
920157160 1:203962852-203962874 TTTCTTATAGGGCAGATATTTGG - Intergenic
922018002 1:221672010-221672032 TTTATGATGGGGCACATAGTGGG - Intergenic
922895694 1:229098302-229098324 TTTTTCATTGGTGATATAGTGGG - Intergenic
923154453 1:231265343-231265365 TTTTTCATGCGGCGTACCTTTGG + Exonic
923281597 1:232448396-232448418 TTTCTCAAAGGGCAAATATTAGG - Intronic
923818408 1:237406082-237406104 GTTTTCATGAGGGAGATATTTGG - Intronic
924378268 1:243436269-243436291 TTTTTCATGGGTCGTACCTTTGG + Intronic
924390786 1:243553768-243553790 TTTTTCCTGGGGCAAATGGTAGG - Intronic
924902615 1:248417654-248417676 TTTTACATTTGGCAGATATTAGG + Intergenic
1065491755 10:26289396-26289418 TTTCTCATGGGGTTTATCTTAGG - Intronic
1067688698 10:48485893-48485915 TTTTTTATCAGGCATATAGTTGG + Intronic
1068241367 10:54305749-54305771 TTTTTAAGGAGGCATATATGAGG + Intronic
1068460679 10:57324389-57324411 CTTTTCCTGGGGTATATAATGGG - Intergenic
1072269190 10:93758857-93758879 TTTTTAATATGGCATATATTTGG + Intronic
1072797362 10:98366127-98366149 TTCTTCATAGGGCATATTTCTGG + Intergenic
1072866229 10:99065212-99065234 TTTTTCATGATTCATATTTTTGG - Intronic
1074836202 10:117297614-117297636 TTTATTATGGGGGATATATCTGG + Intronic
1076263204 10:129088293-129088315 ATTTTTATTGGGCATATATCTGG - Intergenic
1077290726 11:1790256-1790278 TTTTTCATGGGCCATATTTTTGG + Intergenic
1079694563 11:23464123-23464145 TTTTTCATGGATCATATCTTTGG - Intergenic
1081555122 11:44152244-44152266 TATTTCATGGGTTATATCTTTGG + Intronic
1081982530 11:47277279-47277301 TTTCTCTTTGGGCATATATTTGG + Intronic
1086743511 11:90397779-90397801 TTATTTATGGGTCATATTTTTGG - Intergenic
1086746047 11:90428000-90428022 TGTTTCATTGAGCCTATATTAGG + Intergenic
1087523741 11:99280199-99280221 TTTCTCATGGGGCTTAAATTGGG + Intronic
1088761725 11:112935945-112935967 TCTTTCATGGGTCATACTTTTGG + Intergenic
1090663595 11:128900090-128900112 TTTTTTAAAGGGCAGATATTAGG - Exonic
1090967335 11:131610376-131610398 TTGTTCCTGGGGCTTTTATTGGG + Intronic
1093645125 12:21577309-21577331 TGTATCATGTGGCACATATTAGG - Intronic
1095634317 12:44414695-44414717 TTTTTCATGAATCATATTTTTGG - Intergenic
1098008348 12:66022531-66022553 TATTTTATGGGATATATATTGGG - Intergenic
1099915688 12:88890031-88890053 TTTCTCTTGGGGCATTTATATGG + Intergenic
1100667994 12:96775920-96775942 TTTTACATAGGGCATAGAGTTGG + Intronic
1101218798 12:102615072-102615094 TTTTTCATGGGGAAGAAATTGGG + Intergenic
1101464452 12:104933705-104933727 TATTTCATGGTGTATATATATGG - Intronic
1101571026 12:105953946-105953968 TATATCATGGGGCTTATATTGGG - Intergenic
1102076496 12:110064257-110064279 TGTTGCCTGGGGCATATTTTTGG + Intronic
1102618871 12:114177744-114177766 TTATTCCTGTGGTATATATTCGG - Intergenic
1102720377 12:115010817-115010839 TTTTTCATGAGGCACCCATTAGG - Intergenic
1103465926 12:121141934-121141956 TGTTGCCTGGGGCATATGTTTGG - Intronic
1104152115 12:126093822-126093844 TTTTAAATGTGGCATTTATTAGG - Intergenic
1106884092 13:34164584-34164606 CTTTTCACGTGGCTTATATTAGG - Intergenic
1106934492 13:34703429-34703451 TTTTTGGGGGGTCATATATTAGG - Intergenic
1108979943 13:56498031-56498053 TATATGAAGGGGCATATATTAGG - Intergenic
1109517396 13:63461834-63461856 TTTTTCTTGGGCCTTATGTTTGG - Intergenic
1111807442 13:93054915-93054937 ATTTTAATGGGCCAAATATTTGG + Intergenic
1112266381 13:97927639-97927661 TTTTTCATTGAGCTTTTATTTGG + Intergenic
1113332556 13:109344377-109344399 TAGTTCATGGGTGATATATTGGG - Intergenic
1113580790 13:111427216-111427238 CTTTTCCTTGGGCATACATTTGG + Intergenic
1115065094 14:29250112-29250134 TTTTTTAGGCGTCATATATTAGG + Intergenic
1115254733 14:31387492-31387514 TATTTCAAGTGGCATAAATTAGG - Intronic
1116653103 14:47619282-47619304 TTATTCATGTGGTTTATATTTGG - Intronic
1117453022 14:55870161-55870183 TTTATCATGAGACGTATATTTGG + Intergenic
1118180790 14:63490879-63490901 TTTTTCTTTGGGTATATATCCGG - Intronic
1119321696 14:73735576-73735598 TCTTTCAAGTGGCATACATTGGG - Intronic
1120375480 14:83700258-83700280 TTTTTGATGGTGCATAAATGTGG - Intergenic
1121556830 14:94844457-94844479 TTCTGCATGGGGCATAAAATAGG - Intergenic
1121757821 14:96417940-96417962 TATATCATAGTGCATATATTTGG - Intronic
1202928694 14_KI270725v1_random:19042-19064 TGTTTCCTGGGGTTTATATTAGG + Intergenic
1124566708 15:30822411-30822433 TATTTCACAGGGCACATATTAGG - Intergenic
1125169897 15:36754465-36754487 CTTTTTATGGGGCAGCTATTGGG + Intronic
1128003163 15:64213202-64213224 TTTTTTATGTTTCATATATTGGG - Intronic
1128011976 15:64306038-64306060 TTTTTCCTATGGCATATAGTAGG - Intronic
1129629496 15:77243455-77243477 TTTTTCCTGGGAAATAAATTAGG - Intronic
1130239110 15:82169013-82169035 CCTTTCTTGGGGCATAAATTGGG - Intronic
1131244978 15:90783330-90783352 TTTTCCATGGAGAATATTTTTGG + Intronic
1132069085 15:98759726-98759748 TAGTTCATGGGGCACATAGTTGG + Intronic
1132132423 15:99294955-99294977 TCTGCCATGGGGCATATTTTGGG - Intronic
1132445935 15:101918604-101918626 TTTTCCTTTGGGCATATATGCGG - Intergenic
1133381373 16:5333469-5333491 TTTTTCATTGTGTATATAATCGG - Intergenic
1133731962 16:8585698-8585720 TTTTTCATGGAGGATATAATGGG + Intronic
1136984964 16:35093735-35093757 TTTTTTAAGGGGGTTATATTTGG + Intergenic
1137384560 16:48029670-48029692 GTTCTCAAGGGGCCTATATTTGG + Intergenic
1138291452 16:55850924-55850946 TTTTGCATGTGTCATATACTAGG - Intronic
1138849444 16:60608841-60608863 ATTTTCATGGTGTATATATTTGG + Intergenic
1141293489 16:82743929-82743951 TTGTTCATCTGGCATGTATTAGG + Intronic
1142655997 17:1394651-1394673 TTTTTTAATGGGCACATATTAGG - Intronic
1144194613 17:12878259-12878281 TTTTTCATGGAACAAATTTTGGG + Intronic
1146719052 17:35110455-35110477 TTTTTCATGGATCATACTTTTGG + Intronic
1148608400 17:48947238-48947260 CTTTTCATAGGGCATACACTGGG - Intergenic
1154352419 18:13595754-13595776 TTAATCATAGGGTATATATTGGG + Intronic
1154462711 18:14610830-14610852 TTTTTCATGGAGAAAACATTGGG - Intergenic
1156145366 18:34169574-34169596 TTTTGTAAGTGGCATATATTTGG - Intronic
1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG + Intergenic
1157787479 18:50497736-50497758 TTTTTCATTGCTCATATGTTTGG + Intergenic
1158391367 18:57048051-57048073 TTTTTCATGGTGCATGCATTTGG - Intergenic
1159106744 18:64010755-64010777 TTTTTTAAGGTGCATATATATGG + Intergenic
1159281106 18:66287268-66287290 GTTTTCTTGGGGAAAATATTAGG + Intergenic
1160111760 18:76038974-76038996 TTTTTCTTATGGCATCTATTAGG - Intergenic
1160639372 19:115103-115125 TTTTCCTTTGGGCATATATGCGG + Intergenic
1166595125 19:44040881-44040903 ATTTTCATGGGACATATTCTGGG - Intergenic
1168380533 19:55917508-55917530 TTTTTTAAGCAGCATATATTTGG - Intronic
927625319 2:24710737-24710759 TATTCCATGGGGAAAATATTTGG - Intronic
928558961 2:32458638-32458660 TGTTTCATTGGTCATTTATTTGG + Intronic
928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG + Intronic
929239216 2:39636503-39636525 TAATTCATGGTGCATATTTTTGG + Intergenic
930088181 2:47513200-47513222 ATTTTCATGGGTCACACATTAGG - Intronic
930194927 2:48499699-48499721 TTTTTCATGAGGCAGATTGTTGG + Intronic
930442172 2:51422753-51422775 TTTTACATGGGGTATATTCTAGG - Intergenic
930945840 2:57074566-57074588 TGTTTCATGGAGTATATATTTGG + Intergenic
931980403 2:67688058-67688080 TTTTTAAGGGGAAATATATTTGG + Intergenic
933626989 2:84612377-84612399 TCTTTCAGGGTGCATATATGTGG + Intronic
934144379 2:89077174-89077196 TTTTTCATGGGGTAAAAATATGG + Intergenic
939283433 2:140095947-140095969 CTTTTCTTGAGGGATATATTGGG - Intergenic
941589168 2:167397363-167397385 TTTTTCCTGAGGCAAATATGAGG + Intergenic
941785530 2:169494168-169494190 TTTTTCATGAGGCAGGTATGTGG + Intronic
942809331 2:179978726-179978748 TTTTTTTTGTGGCTTATATTTGG - Intronic
943825675 2:192388267-192388289 TTTTTCATGAAGAACATATTCGG + Intergenic
944292759 2:198026340-198026362 TTTTTCATGGAGCATGTTTTGGG + Intronic
944824906 2:203472991-203473013 TTTTGAATGTGGCATATTTTGGG - Intronic
945030527 2:205659121-205659143 TTTTTCAAAGGGAATATAGTTGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945635288 2:212341642-212341664 ATTTTTATGGGACATATATTAGG - Intronic
945670566 2:212797838-212797860 TTTTTAATGGGACATTGATTCGG + Intergenic
946569592 2:221008740-221008762 TTATACATGGACCATATATTGGG + Intergenic
946997978 2:225417806-225417828 TTTTTCATTAAGCATATATTGGG + Intronic
948318407 2:237048305-237048327 TCTATCATGGGGCTAATATTAGG - Intergenic
949029108 2:241780913-241780935 TTTTCCAAGGGGCATTTATTGGG + Intronic
1169386731 20:5156286-5156308 TTTTCCATGGGGCACATTTCAGG + Intronic
1170355058 20:15483089-15483111 TTTTTCATAAAGCATGTATTTGG + Intronic
1176590717 21:8647626-8647648 GTTTTCCTGGGGTTTATATTAGG + Intergenic
1176811815 21:13547549-13547571 TTTTTCATGGAGAAAACATTGGG + Intergenic
1177327796 21:19614859-19614881 TTGTTCTTGGGGCATATTCTTGG + Intergenic
1177348561 21:19903668-19903690 TTTTTCATGGAGCATGCTTTTGG + Intergenic
1177419364 21:20836231-20836253 TTTTTAATGGGACATAAATTGGG - Intergenic
1179142923 21:38742716-38742738 TTTTTCATGGAACACATCTTTGG + Intergenic
1179402540 21:41097248-41097270 GTTTTCATTAGGCATACATTTGG + Intergenic
1180273546 22:10624660-10624682 GTTTTCCTGGGGTTTATATTAGG + Intergenic
1180597926 22:16991296-16991318 TTTTTCCTGAGGCAGATATATGG - Intronic
1180895644 22:19330137-19330159 TTCTGCATGGGGGGTATATTAGG + Intergenic
949652863 3:6180947-6180969 TTTTTCCTGGGGAATATTTATGG - Intergenic
951096229 3:18634489-18634511 TTTTTTACGGGCCATTTATTTGG + Intergenic
951105598 3:18738345-18738367 TTTTTCATGGAGTTTATAGTTGG - Intergenic
951229472 3:20160270-20160292 TTTTTAATGGAGGAGATATTGGG - Intergenic
951459987 3:22940980-22941002 TTTTCTTTGGGGCACATATTTGG - Intergenic
952917425 3:38258546-38258568 TCTTTCATGGAGCACATCTTTGG + Intergenic
955877398 3:63506695-63506717 TTTTTCATATGGCATACTTTGGG + Intronic
956304952 3:67813594-67813616 TTTTACATGGGGGATATTTAAGG + Intergenic
956788626 3:72663030-72663052 TTGTTTATGGTGGATATATTTGG - Intergenic
957302656 3:78412406-78412428 CTATTCATCGGGCACATATTAGG - Intergenic
957472709 3:80679824-80679846 ATTTTCATGTGGCAATTATTGGG - Intergenic
957478931 3:80765380-80765402 TTTTTCATGGGGCTTACATATGG + Intergenic
959473861 3:106785718-106785740 TTATATATGGGGCATATATTGGG - Intergenic
960211067 3:114966891-114966913 TTTTTCATGGGAAACATTTTAGG + Intronic
964313163 3:155415824-155415846 CTTCTCATGGGGCACATATGAGG - Intronic
964544440 3:157818186-157818208 TTTTTCGTGGGGCATCTCCTGGG - Intergenic
965147947 3:164930209-164930231 TTTTTCTTGTTGCATATTTTTGG - Intergenic
966512858 3:180783574-180783596 TATTTCATGGGGCATTTCATGGG - Intronic
969536769 4:7761052-7761074 TTGTTCCTGGGGCATGTTTTGGG + Exonic
969854105 4:9985328-9985350 GTTTTCATGGGGCTTTTATGAGG - Intronic
969943161 4:10755331-10755353 TTTTTTATTGTACATATATTGGG + Intergenic
970108482 4:12611296-12611318 TTTTTCAGGGGGAGTCTATTGGG + Intergenic
971086025 4:23275959-23275981 TTTATCAGGAGGCCTATATTAGG - Intergenic
971882320 4:32393004-32393026 TTTTTCATAAGACATACATTTGG - Intergenic
972856318 4:43111893-43111915 TTATTCTTGAGGCATATATTAGG + Intergenic
972919753 4:43923932-43923954 TTTATAATGAGGCAAATATTAGG - Intergenic
973606449 4:52592271-52592293 TTTTTAATTAGGCATTTATTTGG - Exonic
974868952 4:67614563-67614585 TTTTTCATGAGGAATTAATTTGG - Exonic
977967565 4:103170768-103170790 TCTTTCAGGCAGCATATATTTGG - Intronic
978487577 4:109273031-109273053 TTTTTCATGGGGCATATATTGGG - Intronic
978903112 4:113977097-113977119 TATTTCATGAGCCATATATAAGG + Intronic
980447934 4:132936202-132936224 TTATTGCTGGGGCATATATGTGG + Intergenic
982165537 4:152610462-152610484 ATTTTCATTGGGCATAAACTAGG - Intergenic
983482191 4:168289016-168289038 TACTCCATAGGGCATATATTTGG + Intronic
983795484 4:171856451-171856473 TTTTTTATGAATCATATATTTGG + Intronic
984138198 4:175968389-175968411 TCTTTCATGAGTCATATGTTTGG - Intronic
984691350 4:182729881-182729903 TTTTTCATAAGTCATATATATGG - Intronic
984923506 4:184786460-184786482 TGTTTCATGTGCCATATGTTAGG + Intronic
985019522 4:185672778-185672800 TTTATAATGGAGCACATATTTGG + Intronic
985920568 5:2968856-2968878 GTTTTCATGTGGGAGATATTAGG + Intergenic
987555219 5:19437605-19437627 TTTGTCATTGGGAATATCTTGGG - Intergenic
988178282 5:27755944-27755966 TTTTTCAAGGGGGATGTTTTCGG - Intergenic
988913703 5:35871345-35871367 GTTTTCATGGGGCCAATATTGGG - Intronic
988936886 5:36092841-36092863 TTTTTCAAGGGTAATATATCTGG - Intergenic
989321406 5:40138620-40138642 TTTTTAATGTGCCTTATATTTGG - Intergenic
989844117 5:46117763-46117785 TTTTGCTTGCAGCATATATTAGG + Intergenic
990131023 5:52583326-52583348 TTTTTTTTGTGGCATATAGTTGG - Intergenic
990221329 5:53592421-53592443 TTTTTCATGGATCATTTTTTTGG + Intronic
990989301 5:61669663-61669685 TCTTTCATGAGGCACATTTTTGG + Intronic
991294602 5:65067138-65067160 TTTTTCCTGGGGCCAATTTTCGG - Intergenic
991619929 5:68534634-68534656 TGTCCCATGGGGCATATATCAGG - Intergenic
993563188 5:89438053-89438075 TGGTTCAGGGGGCAGATATTTGG + Intergenic
994752054 5:103750399-103750421 TTTTTCATTTGGCTTTTATTTGG + Intergenic
995254139 5:110027021-110027043 TTTCTCTGGGGGTATATATTGGG - Intergenic
995308194 5:110679548-110679570 TTTTTCATAGAACATGTATTTGG + Intronic
995540218 5:113178463-113178485 TTATTTATGAGGGATATATTGGG + Intronic
995900988 5:117066335-117066357 TTTTTCCTCTGGCATATACTTGG + Intergenic
996115751 5:119616280-119616302 TTTATCTTGGAGCAAATATTTGG + Intronic
999885944 5:155922876-155922898 TTTTTCAGTGGGCATTGATTGGG - Intronic
1000342913 5:160291316-160291338 TTTTTCAGGGAGCATATCTTGGG - Intronic
1000928624 5:167224952-167224974 TTTTTCATGGCTTATATAATTGG + Intergenic
1001161447 5:169319989-169320011 TTTTTCATGGTTAAAATATTAGG - Intergenic
1001625613 5:173130128-173130150 TTTTTTATGTAGCATGTATTTGG + Intronic
1002432801 5:179212948-179212970 TCTTTCAGGGGGCCTAAATTTGG - Intronic
1002530887 5:179844240-179844262 TTTTTCAAAGGGCATATGTATGG - Intronic
1002746723 6:63509-63531 TTTTCCTTTGGGCATATATGCGG + Intergenic
1004305409 6:14497529-14497551 TTTTTCATGGTGCACATTTTGGG + Intergenic
1005197450 6:23304810-23304832 TTTTTCATGTGAAAAATATTTGG + Intergenic
1005253729 6:23977106-23977128 TTTTCCATGCAGCATCTATTTGG + Intergenic
1006147812 6:31969708-31969730 TTTTACATGGGGCATTCACTGGG - Exonic
1007360851 6:41354231-41354253 TTTTCCATGGGGCGTTTCTTTGG - Intergenic
1007592341 6:43029967-43029989 TTTTTAGTGGGCCACATATTGGG + Intronic
1007843152 6:44733121-44733143 TTTTACATCGAGTATATATTAGG + Intergenic
1008430569 6:51411973-51411995 CTTTACATGGGGCATAAATGTGG + Intergenic
1009194890 6:60672226-60672248 TTATTAATGGGGAATATAATTGG - Intergenic
1009504382 6:64456694-64456716 ATTTTTCTGAGGCATATATTTGG + Intronic
1010098183 6:72071799-72071821 ATTTTCATGGGGGAACTATTAGG + Intronic
1010694321 6:78951258-78951280 TTTTTCTTGGCTCATATCTTGGG + Intronic
1011105987 6:83782191-83782213 TTCTTCATGGTGAATATATCTGG - Intergenic
1014430364 6:121363328-121363350 ATTTACATGGGGTAAATATTTGG - Intergenic
1016465301 6:144319374-144319396 TGTTTCATGAGGCATTTACTTGG + Intronic
1016530014 6:145048521-145048543 TTTTACATGGTGCACATGTTAGG + Intergenic
1017322775 6:153112160-153112182 TTTTTCAAGGTTCTTATATTGGG - Intronic
1018624279 6:165762756-165762778 TTTTCTCTGGGACATATATTTGG + Intronic
1019076384 6:169391427-169391449 TTTCTCAAGGGGCTTTTATTGGG + Intergenic
1019078935 6:169414308-169414330 TTTTCCCTGGGGCATTTCTTGGG + Intergenic
1020476927 7:8607055-8607077 TTTTTCCTGGGACAAATATACGG + Intronic
1020982628 7:15090400-15090422 TATTTCATGGAGAATATATGTGG + Intergenic
1021241730 7:18210147-18210169 TTGTTCATTGGGCATTTATTGGG + Intronic
1023409278 7:39872706-39872728 TTTTAGATGTGGCATATGTTAGG + Intergenic
1028672632 7:93420723-93420745 TTTAGCTTGGGGCATTTATTTGG + Intergenic
1028925481 7:96353116-96353138 TTTAGCAAGGGGCACATATTTGG + Intergenic
1031829184 7:126605470-126605492 TTTTTCCTGGAAAATATATTAGG - Intronic
1031840063 7:126726850-126726872 TTTTTCTTGGAGCAAATCTTGGG - Intronic
1036681013 8:10874232-10874254 TTTTTAATGGGGCTTATTTTTGG - Intergenic
1038016347 8:23518911-23518933 GTGTTCCTGGGGTATATATTAGG + Intergenic
1038554888 8:28503056-28503078 GTGTTCATGGGGCATATAGGTGG + Exonic
1039810790 8:41046591-41046613 TATTTCATGAGTCATGTATTTGG + Intergenic
1039856064 8:41415387-41415409 TTTTTCATGTGCTATTTATTGGG + Intergenic
1042350304 8:67770310-67770332 TTTCTCCTGGGGAATCTATTTGG + Intergenic
1042493344 8:69427945-69427967 TTTTTCATAAGTCATATAGTTGG + Intergenic
1042638962 8:70911397-70911419 TTTTTGATGGTGCAGTTATTAGG + Intergenic
1042788366 8:72575051-72575073 TTTCCCATGGGGCATATACCTGG + Intronic
1043655926 8:82664763-82664785 TTTTTCTTGGGTCAGATATAAGG - Intergenic
1044606080 8:94048825-94048847 TTTTTCATGGATCATGCATTTGG + Intergenic
1044615068 8:94131648-94131670 TTTATCATGGGTCATCTTTTAGG + Intronic
1044714364 8:95087087-95087109 TTCTGCATGGTGCATATTTTTGG + Intronic
1044913905 8:97091566-97091588 TTTTTCATGGTGAACATTTTAGG + Intronic
1048025304 8:130581137-130581159 TTTTTCTTCGTGCATATATTAGG + Intergenic
1051069471 9:13146755-13146777 TTTTTCATGAGGCATAAAGAAGG + Intronic
1051102247 9:13535060-13535082 TTTTGGATGTGGCATAAATTAGG + Intergenic
1052139347 9:24959755-24959777 ATTTTAATGGGACATATATTTGG - Intergenic
1052172625 9:25420175-25420197 TTTATAATGAGGCTTATATTTGG + Intergenic
1053275765 9:36782240-36782262 TGCATCATGGGGCATATAATGGG - Intergenic
1055284504 9:74714031-74714053 TAGTTCATAGGGCATACATTGGG - Intergenic
1055906820 9:81304374-81304396 TTTTTCATGGAGCATGCCTTTGG - Intergenic
1056308716 9:85318951-85318973 TCTTTTATGGATCATATATTTGG - Intergenic
1057366083 9:94422510-94422532 TGTTTCTTGGGGTATATATCTGG + Intronic
1058432603 9:104931947-104931969 TTTTTTAAGGGGCATCTCTTAGG - Intergenic
1059654006 9:116340692-116340714 TTTTTCATGGGACATTTCTTAGG - Intronic
1059698533 9:116752496-116752518 TTTCTCATGGATCATATATTTGG - Intronic
1060535652 9:124385211-124385233 TTTATTATGTGGCATTTATTTGG + Intronic
1061717645 9:132530797-132530819 TCTTTCATGGGTTATATTTTTGG + Intronic
1203620730 Un_KI270749v1:126350-126372 TGTTTCCTGGGGTTTATATTAGG + Intergenic
1186673400 X:11790538-11790560 TTTTCCATGGGGCATAGAAAAGG - Intergenic
1187189743 X:17022816-17022838 TCTTTCTTGGGGAACATATTTGG + Intronic
1187664045 X:21584435-21584457 TTTTTAATGGAGTTTATATTTGG + Intronic
1188672896 X:32902403-32902425 TTTTGCATGTGGTATATATTTGG - Intronic
1189756752 X:44279869-44279891 TTTTTCATGGTACGTCTATTAGG - Intronic
1190014040 X:46811268-46811290 CTTTTCTTGGGGCATTTTTTTGG + Intergenic
1192286608 X:69745064-69745086 TTTTTCATTGGACAGATATGTGG + Intronic
1192753066 X:74015082-74015104 TTTTACATGCAGCATATAGTTGG - Intergenic
1192756407 X:74050420-74050442 TTTTGCAGGGCGGATATATTAGG - Intergenic
1193293941 X:79810882-79810904 TTTATCATGGGTCACACATTTGG + Intergenic
1194235098 X:91372996-91373018 TGTTTCACAGGGCCTATATTAGG - Intergenic
1194488406 X:94515360-94515382 TTCTTTATGGGGCATTTACTTGG + Intergenic
1196201082 X:112886766-112886788 ATGTTCAAGTGGCATATATTTGG + Intergenic
1196735836 X:118980260-118980282 TTTTGCAAGGACCATATATTAGG + Intronic
1197549090 X:127866094-127866116 TTTTTTATGCAGCATATAGTTGG - Intergenic
1199558783 X:149140037-149140059 TTTCTGGTGGGGCATATATTAGG + Intergenic
1199715917 X:150507343-150507365 GTTTTCTTGGGGCTTATCTTTGG + Intronic
1200924919 Y:8645793-8645815 TTTTTCATGGGGCAGAGTTTTGG - Intergenic
1201451726 Y:14122870-14122892 TTTATCATGGGTTTTATATTGGG - Intergenic