ID: 978487807

View in Genome Browser
Species Human (GRCh38)
Location 4:109276012-109276034
Sequence ATGGAGGAGAAGAGTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 729}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978487807 Original CRISPR ATGGAGGAGAAGAGTGAGCA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900382149 1:2390328-2390350 TTGCAGGAGATGAGTGAGCCAGG + Intronic
900492903 1:2961517-2961539 GTGGATGAGAAGACAGAGCAAGG + Intergenic
900538184 1:3189258-3189280 ATGGAGGAGAAGGGCTAGCAGGG - Intronic
900564187 1:3324291-3324313 AGAGAGGAGGAGAGTGAGCCCGG - Intronic
900852711 1:5156695-5156717 AGGGAGGGAAAGAGGGAGCAGGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
901122067 1:6904031-6904053 ATTGCTGAGTAGAGTGAGCAAGG - Intronic
902202284 1:14842838-14842860 AAGGAGGAGAAGGGTGGCCATGG - Intronic
902911225 1:19598678-19598700 ATGGGCGAGAAGAGTGAGAGTGG - Intronic
903427698 1:23266651-23266673 ATTTTGGAAAAGAGTGAGCATGG + Intergenic
903573955 1:24326326-24326348 GTGGAGGGGAAGAGGGAGAATGG - Intronic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904902620 1:33869418-33869440 ATGGAGGAAATGGGTGGGCACGG + Intronic
904905204 1:33892468-33892490 TTGGAGGAGAAGATTGAGAGGGG - Intronic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
905290889 1:36921029-36921051 CTGGAGGTGGAGAGTGGGCATGG + Intronic
905320522 1:37113569-37113591 ATGAAGGAGAAGAAAAAGCATGG - Intergenic
905891728 1:41522263-41522285 ATGGGGGTGAAGGGAGAGCAGGG - Intronic
905893708 1:41532177-41532199 ATGGAGGACAAGAGAGATGAAGG + Intronic
906191128 1:43900130-43900152 ACAGAGGAGAAGAGGGTGCAAGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
909046874 1:70720993-70721015 GTGGCTGAGAATAGTGAGCAAGG + Intergenic
909640144 1:77863296-77863318 AGGGAGGAAAGGAGTGAGCAGGG - Intronic
909805825 1:79873260-79873282 AGGGAGGAAATGAGTGAACATGG + Intergenic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
911042401 1:93600992-93601014 GTGGAGGAGAGGAGAGAGCTTGG + Intronic
911119427 1:94280565-94280587 AAGGAGGAGAAGAGTGATCCTGG + Intergenic
911253576 1:95608154-95608176 AAGGATGAGAAGAGTGGGCATGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912037357 1:105334964-105334986 TTGGAGGAGAAGATTGATGATGG + Intergenic
913131916 1:115846519-115846541 TTGGGGGAGAAAAGGGAGCAAGG + Intergenic
913538119 1:119793795-119793817 GTGGGGGAGAAGAGTGTCCAGGG + Intergenic
914913851 1:151806285-151806307 ATGGAGGACACCAGGGAGCAGGG - Intronic
915216777 1:154345777-154345799 CTGGAAGAGAACAGGGAGCAAGG - Intronic
915330554 1:155109288-155109310 ATGGAACACAAGACTGAGCATGG - Intergenic
915443405 1:155960919-155960941 AGGGAGGAGAAGAGACAGCAGGG - Intronic
915895554 1:159808696-159808718 ATAGAGGGGAAGGGTGAGCCTGG - Intronic
915938979 1:160106506-160106528 ATGGAGGGGAACACTGAGCCAGG - Intergenic
917380364 1:174399748-174399770 AGAAAGGAGAAGAATGAGCAGGG + Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
918730204 1:187983917-187983939 AAGGAGGAAAAGAGAGAGTAGGG + Intergenic
919705456 1:200670563-200670585 ATGGGGGAGAGGAGACAGCACGG + Intergenic
919745187 1:201004360-201004382 CTGGAGGAGCCGAGTGAGCTTGG + Exonic
919956297 1:202420286-202420308 GGGGAGGAGAAGAGGGAGTATGG + Intronic
919973286 1:202594464-202594486 ATGGGTGAGAAGAGTGAGTCTGG + Exonic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
921068038 1:211636766-211636788 ATGGAGGAGTAGAGTCGGCTGGG + Intergenic
921991981 1:221376814-221376836 ATGGAATAGAAAAGTGAGTAAGG + Intergenic
922119360 1:222647781-222647803 ATGGAGCAGAGGAATTAGCAAGG + Intronic
922139278 1:222866083-222866105 AAGGAGGAAAAGAGTAAGCAGGG - Intergenic
922329541 1:224562273-224562295 CTGGAGTAGAAGGGTCAGCAGGG - Intronic
922564583 1:226593408-226593430 TGGGAGGAGAAGGGTGAGGATGG - Intronic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922967192 1:229700220-229700242 TTGTAGGAGAGGAGTGAGCTTGG + Intergenic
923281034 1:232443075-232443097 TGGGAAGAGAAGAGGGAGCATGG - Intronic
923660849 1:235955869-235955891 AGGGAGGATAACAGTGATCATGG - Intergenic
923827414 1:237515782-237515804 AAGGAGGAGAAGAGGAAGTAGGG - Intronic
923852780 1:237815620-237815642 ATGAAGGAGAGCAGTGAGGAAGG + Intronic
924751846 1:246901037-246901059 ATGGGGAATAAGAGAGAGCATGG + Intronic
924802012 1:247334615-247334637 ATGGTGGGGAAGAGTGTGCTGGG + Intergenic
924802143 1:247335358-247335380 GTGGAGGAGAAGGGAGAGAAGGG + Intergenic
1063065562 10:2605140-2605162 ATGGACCAGAGGAGTGAGCCAGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064533264 10:16331892-16331914 ATGGCAGAGTGGAGTGAGCAAGG + Intergenic
1064594126 10:16926104-16926126 ATGGATGAGAGGAGGGAGAAGGG + Intronic
1064614689 10:17140549-17140571 CTGGAGGAAAAAAGTCAGCAGGG + Intergenic
1064701383 10:18024506-18024528 AGAGTGGAGAAGAGTGAGAAAGG - Intronic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1065734503 10:28739243-28739265 ATGGAGGCCAAGGGAGAGCATGG + Intergenic
1065826422 10:29576238-29576260 ATTGAGAAGAAGAGTGCACAAGG - Intronic
1065895640 10:30160989-30161011 CTGAAGCAGAAGAGTGGGCACGG + Intergenic
1066300431 10:34091186-34091208 GTGGAGGAGACGAGGGAACAAGG + Intergenic
1067346070 10:45440041-45440063 AGGCAGTAGAAGAGGGAGCAGGG + Intronic
1068004741 10:51380021-51380043 ATGGTGGAGAAGAATGAGCCAGG - Intronic
1068447125 10:57138017-57138039 GTGGAAGTGAAGAGTGATCAGGG - Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1070102209 10:73399076-73399098 ATGAAGGAAGAGAGAGAGCATGG - Intronic
1070106547 10:73438015-73438037 AAGGTGGAGAGCAGTGAGCAAGG - Exonic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070325719 10:75387719-75387741 AAGGTGGAGGAGAGGGAGCAGGG + Intergenic
1070341934 10:75505926-75505948 ATGGAGGAGGAGAGTTAATATGG - Intronic
1070674555 10:78403518-78403540 AGAGAGGAGAAAAGTGGGCATGG - Intergenic
1070825332 10:79387395-79387417 GGGGAGGAAAAGAGCGAGCAGGG - Intronic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071460728 10:85892303-85892325 ATGAGGGAGAAGAGAGAGAAGGG + Intronic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072273767 10:93802404-93802426 AGGGAGGAAAAGAGGGAACAAGG + Intergenic
1073263524 10:102208675-102208697 ATGGAGGAGATAAGTGAGGCAGG - Intergenic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1073949194 10:108786547-108786569 AGAGAGGAGAAGAGAGAGCCTGG - Intergenic
1074942262 10:118247104-118247126 ATGTAGGAGAAGGGAGAGAAGGG - Intergenic
1075387272 10:122064295-122064317 ATGGAGGAGGGAAGTGTGCATGG - Intronic
1075531073 10:123230291-123230313 GAGGAGGGGGAGAGTGAGCAGGG - Intergenic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1076375022 10:129977822-129977844 AGGGAACAGAAGAGTCAGCAAGG + Intergenic
1076711750 10:132339501-132339523 CTGGAGGAGAAGAGTGTTCCGGG + Intronic
1077218345 11:1404461-1404483 ACGGAGGGGAAGACAGAGCAAGG - Intronic
1077373876 11:2196082-2196104 CTCGAGGATAATAGTGAGCATGG - Intergenic
1077618380 11:3696209-3696231 ATGGAGGAAAACACTGGGCACGG + Intronic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078379950 11:10830868-10830890 AGGAGAGAGAAGAGTGAGCAGGG + Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1078524778 11:12091904-12091926 AGGGAGGAGAAAAGGGAGGAAGG - Intergenic
1078836663 11:15036693-15036715 AAGGAGGAGGAGAGAGAGAAAGG - Intronic
1078873092 11:15367222-15367244 GGGGAGGAGAAGAGTAACCAAGG + Intergenic
1079171584 11:18101462-18101484 AGGAAGGAGAAGTGCGAGCAGGG - Intronic
1080402502 11:31949192-31949214 ATGGAGGCCAAAAGAGAGCAGGG + Intronic
1081152772 11:39652372-39652394 ACTGACGAGAAGAGTGAGGAAGG + Intergenic
1081279449 11:41190236-41190258 ACGGAGGACAAGAGAGAGGAAGG + Intronic
1081434058 11:43007565-43007587 ATGAGTGAGAAGAGTGAGAAGGG + Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1081720794 11:45286630-45286652 CTGGGGTAGAAGGGTGAGCAAGG - Intergenic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1082192349 11:49261799-49261821 ATGGAGGAGTAGGTGGAGCACGG - Intergenic
1082681971 11:56185132-56185154 CTAGAGGAGAAGAGAGAGCAAGG - Intergenic
1082932225 11:58620289-58620311 ATGGAGCAGAAGGGAAAGCAGGG - Exonic
1083170017 11:60918240-60918262 ATGGACGAGGACAGTGAGCAAGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083714939 11:64569738-64569760 ATAGAGGAGAGGAGGCAGCAGGG - Exonic
1084155065 11:67308648-67308670 ATGGGGGAGGAGAGTGGGCGGGG - Intronic
1084164264 11:67367638-67367660 ATGGACGAGAAGCATGAGCGCGG + Intronic
1084229219 11:67738702-67738724 AGGGAGGGGCACAGTGAGCAGGG + Intergenic
1084594065 11:70106781-70106803 GTGGAGGAGAGGAGTGGGGAAGG - Intronic
1084622787 11:70284824-70284846 AGGGAAGGGAAGAGTGAACATGG + Intronic
1084645910 11:70457562-70457584 TTGTAGGAGAAAACTGAGCAGGG - Intergenic
1084813101 11:71627637-71627659 AGGGAAGGGCAGAGTGAGCAGGG - Intergenic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1086127951 11:83369006-83369028 TTGAAAGAGAAGAGTGAGAATGG - Intergenic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087462141 11:98458863-98458885 ATGGAGGAAAAGAGAGAGAAAGG - Intergenic
1087754100 11:102036894-102036916 AGGGAAGAGAAGAGAGAGAAAGG + Intergenic
1088567427 11:111187054-111187076 ATGTAGGAGAATAGTGAGAGTGG - Intergenic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089679275 11:120110338-120110360 ATGGCAGAGAAGAGAGAGAAGGG - Intergenic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1090499820 11:127250523-127250545 AAGGAGGAGAAGGGTTACCAAGG + Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091756655 12:3056783-3056805 ATGGGGGAGAGGAGTTATCATGG - Intergenic
1091796585 12:3300788-3300810 ATGGAGGAGCAGAGACTGCATGG + Intergenic
1091916353 12:4273762-4273784 AGAGCGGAGAAGAGCGAGCAGGG + Exonic
1091951229 12:4594582-4594604 GTGGAGCAGAGGAGGGAGCAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094704788 12:32904204-32904226 AGGGAGGGAAAGAGAGAGCAAGG - Intergenic
1094747143 12:33357961-33357983 ATGGAGGAGAAGAGTTCAAAAGG - Intergenic
1095492960 12:42755517-42755539 CTTGAGGAGAAGAGTGGGAAAGG + Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1097171051 12:57112990-57113012 ATGGAAGAGAAGGGAGAGCAGGG + Intronic
1097323491 12:58250405-58250427 AGGGAGGAGAAGAGTGGACAAGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1100728132 12:97431626-97431648 ATTGAGGAGTAGAGTTACCAGGG + Intergenic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1100870872 12:98908651-98908673 CTTGAGGAGAAGAGTCACCATGG + Intronic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1101226306 12:102691382-102691404 ACGGAGGGGAATAGTGAGCAGGG - Intergenic
1101342199 12:103852682-103852704 AGGGAGGAGAAGAGTCATCCAGG - Intergenic
1101376078 12:104172482-104172504 ATGGAGTGGAAGAGTAAGGAAGG + Intergenic
1101903063 12:108805948-108805970 AGGGAGCAGAAGAGAGAACAAGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102835449 12:116054095-116054117 GTGGAGCAGAGCAGTGAGCATGG - Intronic
1102951482 12:117034418-117034440 TGGGTGGAGAAGACTGAGCAGGG - Intergenic
1103192789 12:119016641-119016663 ATGGAGGAGAATATGGAACAGGG - Intronic
1103743186 12:123105124-123105146 AAGGAGGTGAGGAGTGAGCCAGG - Intronic
1104158415 12:126155060-126155082 AAGGAGGAAAAGAGGGAGAAAGG + Intergenic
1104390211 12:128385655-128385677 TTGGAGGAGAACAGGGAGTAAGG + Intronic
1105072492 12:133243326-133243348 GTGGAGGAGAAGAGTAAATATGG + Intergenic
1105337223 13:19484799-19484821 ATGGAAGCCAAAAGTGAGCAGGG - Intronic
1106002634 13:25738509-25738531 AAGGAGGTGGAGAGCGAGCAGGG + Intronic
1106231292 13:27823236-27823258 TGGGAGGAGAAGTGTGTGCAGGG - Intergenic
1106484991 13:30164230-30164252 ATGCATGAGAAGAATGAACAGGG + Intergenic
1107037111 13:35912974-35912996 AAGGAGCATATGAGTGAGCAAGG - Intronic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107419279 13:40231647-40231669 ATGAAGGAAATGAGTGAGCCAGG - Intergenic
1107442871 13:40443857-40443879 TTGCAGGGGAAGGGTGAGCAGGG + Intergenic
1107502586 13:40995529-40995551 ATGGAACAGAATAGAGAGCACGG + Intronic
1107635536 13:42388644-42388666 AGGGAGGGAAAGAGTAAGCAAGG - Intergenic
1107877707 13:44805274-44805296 ATGGAGGAAAAGAAGGAGCTAGG - Intergenic
1107965861 13:45597694-45597716 ATGGAGCAGAAGAGGGAGCCTGG - Intronic
1108368530 13:49743273-49743295 ATGGAGCAATAGAGAGAGCAAGG + Intronic
1108494029 13:51006826-51006848 ATGCAAGAGAAGAGTGTTCAGGG + Intergenic
1108954967 13:56141773-56141795 AAGGTGGAGAAAAGGGAGCATGG - Intergenic
1109273869 13:60283083-60283105 AGGGAGGGGAAGAGTGAGAGAGG - Intergenic
1110300993 13:73927263-73927285 GGGGAGGAGAGGAGTGATCAAGG - Intronic
1110430419 13:75416908-75416930 CTGGAGGAGAAAAGAGGGCAGGG + Intronic
1110761074 13:79230919-79230941 ATGGAATAAAAGAGTGAGCTAGG - Intergenic
1112119520 13:96394431-96394453 ATGCAGGACAGGAGTGAGGATGG - Intronic
1112565139 13:100545961-100545983 ATGGAGGAAAAGAGGGGGAAAGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1113593162 13:111514643-111514665 ATGGAAGAAAAGAGTCTGCAAGG + Intergenic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1113753354 13:112791561-112791583 TTGGAGGAGATGACAGAGCATGG + Intronic
1113883426 13:113642743-113642765 ATGAAGGAGAAGAGAAAGAAAGG + Intergenic
1114421407 14:22586634-22586656 ATGGAGGAGTCCAGTGAGCTGGG - Intronic
1115085269 14:29507838-29507860 ATGCAAGAGAAGGGAGAGCAGGG + Intergenic
1115288209 14:31741345-31741367 AGGGAGGAGGGCAGTGAGCAGGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116289982 14:43022375-43022397 AGGGAGGAGAAGAGGGAGGGAGG - Intergenic
1117206476 14:53448857-53448879 ATGGAGGAGAAGAGAGCTGAGGG + Intergenic
1117305583 14:54470150-54470172 ATGGAGGAGAGGATGGGGCAAGG + Intergenic
1118766764 14:68915249-68915271 AAGGAGGGGAAGAAGGAGCAGGG - Intronic
1119649027 14:76370619-76370641 AAGGAGGAGAAGGGAGATCAGGG - Intronic
1119666402 14:76488306-76488328 AGGGAGGAAGAGAGTGATCAGGG + Intronic
1119717851 14:76871359-76871381 ACTGAGGAGAAGAGTGAGAAGGG + Intergenic
1119745399 14:77040278-77040300 GTGGAGGGGGAGCGTGAGCAGGG + Intergenic
1120231503 14:81845855-81845877 ATGGAAGGGAAAAGTGATCAAGG + Intergenic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1121501639 14:94442772-94442794 ATGGTGGACATGAGTGAGAAGGG - Exonic
1121607473 14:95251957-95251979 ATGGAGGAGAAGGATTAGCGAGG + Intronic
1121688699 14:95858792-95858814 ATGTAGGAGAATTCTGAGCACGG + Intergenic
1122307572 14:100775668-100775690 CAGCAGGAGAAGAGTGGGCAGGG - Intergenic
1122556951 14:102585650-102585672 ATCGAGGGGAAGTGTGAGCCAGG - Intergenic
1123697068 15:22886088-22886110 AGGAATGAGAAGAGAGAGCAAGG + Intronic
1124231151 15:27947422-27947444 ATGGCAAAGAAGGGTGAGCAAGG - Intronic
1124587509 15:31023337-31023359 ATGAAGGAGAAGATAGTGCATGG + Intronic
1124620287 15:31270142-31270164 GTGAGGGAGAAGAGTGAGCTGGG + Intergenic
1124621235 15:31275261-31275283 ATGAAGGAGAGGATTGAGTACGG + Intergenic
1124688777 15:31804478-31804500 ATGGAGGAGAAAGGGGAGGAGGG - Intronic
1125520634 15:40346112-40346134 ATTGAGGAAAAGAGTGAGCCAGG + Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126391533 15:48160362-48160384 ATGGAGGAGAGGAGAGATAAAGG + Intronic
1126486649 15:49188431-49188453 ATGGAGGAGTACAGTGATTATGG - Intronic
1127435092 15:58949502-58949524 ATTGAGGAGAAGAGTGTATATGG + Intronic
1127855483 15:62950285-62950307 CTGGAGGAGAGGAGTCAGCTGGG + Intergenic
1128006487 15:64246884-64246906 AGGGAGGGGATGAGTCAGCAAGG - Intronic
1128030642 15:64477116-64477138 AAGAAAGAGAAGAGTAAGCAAGG - Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1128457912 15:67843190-67843212 GTGGAGGAGAGGAGGAAGCATGG + Intergenic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1130059133 15:80557184-80557206 AGGAAGGAGCAGAGTGTGCAGGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130255891 15:82325912-82325934 AGGGAGGAGCAGAGGGAGCTGGG + Intergenic
1130533223 15:84763760-84763782 ATGCAGGATTAGAGTGAGAATGG + Intronic
1130803326 15:87291011-87291033 AAGGAAGACAAGGGTGAGCAAGG + Intergenic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1132585014 16:702303-702325 ATGGAGGAGAAGAGCTTGCAGGG - Intronic
1132958648 16:2610226-2610248 ATAGAGGAGAAGAGGGATCCTGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133554460 16:6891890-6891912 AGGGAAGAAAAGAATGAGCAGGG - Intronic
1134174448 16:11994465-11994487 ATGGAGGTCGAGGGTGAGCAGGG + Intronic
1134264919 16:12684586-12684608 TTGGAGGAAACGAATGAGCAGGG - Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1135682529 16:24470318-24470340 ATAGAGGAGATGTGTGTGCAGGG - Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137396644 16:48120321-48120343 ATGGAGGATGAGAGGGCGCACGG + Intronic
1137459100 16:48642043-48642065 TTGGATGAGAGGAATGAGCAGGG - Intergenic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137534813 16:49312089-49312111 ATGGAAGACAAGTGTTAGCATGG - Intergenic
1138022534 16:53497555-53497577 ATGGAGGAGAAGGCCTAGCAGGG - Intronic
1138658666 16:58504749-58504771 GAGGAGGAGAAGCGAGAGCAGGG - Intronic
1139428592 16:66898918-66898940 ATGGGGTTGAAGAGTGGGCAGGG - Intergenic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1140332719 16:74073324-74073346 ATGGAGGGGAAGAGAGGGGAAGG - Intergenic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141198996 16:81882884-81882906 AGGGAGGGGAAGAGTGGGAATGG - Intronic
1141299081 16:82796323-82796345 ATGGAAGAGAAGAGCGAGATTGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141845109 16:86603342-86603364 AGGAAGGAGAGGAGTGAGAAGGG - Intergenic
1142207513 16:88791180-88791202 ATGGAGGGGAAGAGAGGGGAGGG + Intergenic
1142249762 16:88985920-88985942 ATGGAGGAGAAATGGGGGCAGGG + Intergenic
1143133548 17:4696415-4696437 TTGATGGAGAAAAGTGAGCAAGG + Intronic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143591670 17:7888853-7888875 ATGGAGGTGAAGGGTGAGATCGG + Intronic
1144235458 17:13256569-13256591 ATGGAGTAGAGAAGTGACCAAGG - Intergenic
1144393952 17:14825151-14825173 AGGGAGCAAAAGAGAGAGCAGGG - Intergenic
1145001288 17:19306683-19306705 TTGGAGGGGGAGAGTGGGCACGG - Intronic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1145398226 17:22512396-22512418 ACTGAGGAGAAGATAGAGCAGGG - Intergenic
1145772279 17:27502100-27502122 ATGGCTCTGAAGAGTGAGCAAGG + Intronic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146297194 17:31659270-31659292 AGGGAGGAGGAGAGGGAGAAAGG + Intergenic
1146643964 17:34564066-34564088 TTGGAGGAAAGGAGTGAGTAGGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147036306 17:37684032-37684054 ATGGAGGAATCCAGTGAGCAAGG - Intergenic
1147136726 17:38438366-38438388 ATGGAGGAGAAGGGAGAGAAGGG + Intronic
1147951203 17:44109025-44109047 AGGGAGGAGATGAGAGAGCAGGG + Intronic
1148071290 17:44910384-44910406 AGGGAGGGGAAGAGGGACCAGGG + Exonic
1148113622 17:45161868-45161890 ATGGGGGGGAAGAGAGAGCCTGG - Intronic
1148124528 17:45229995-45230017 TTGGAGGAGAAGGCTGAGAAAGG - Intronic
1148127559 17:45244729-45244751 AAGGAGGAGAAGAGGTGGCAAGG - Intronic
1148206399 17:45783026-45783048 AGGGAGGAGTAGGGTGGGCACGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149161081 17:53694013-53694035 TTGGAGGAGGAGTGTGACCATGG - Intergenic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1149615066 17:57990051-57990073 AGGGAGGAGAAGACTATGCAGGG - Intronic
1149669192 17:58390876-58390898 AGTGTGGAGAAGAGTGATCAGGG - Intronic
1151224200 17:72636523-72636545 ATGAAAGAGATGTGTGAGCAGGG - Intergenic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1151680934 17:75622362-75622384 AGGGAGGGAAGGAGTGAGCACGG + Intergenic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1151763244 17:76119365-76119387 GTGGAGGCAAAGTGTGAGCAAGG + Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152338997 17:79714186-79714208 AAAGAGGAGAGGAGAGAGCACGG - Intergenic
1153103619 18:1502289-1502311 ATGGAGTAGAAAAGAGAGAATGG + Intergenic
1153405093 18:4729134-4729156 ATGTAGGATAACAGTGAGTAGGG - Intergenic
1155996465 18:32335914-32335936 GTGGAAGAGCAGAGTGACCATGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156453323 18:37279022-37279044 ATGGAGGAGGAGGGTGGGCACGG - Intronic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156731790 18:40203256-40203278 ATGAAAGAGAAGAGGGAGAATGG + Intergenic
1156766686 18:40665095-40665117 ATGTACGAGAAGTGTGAACAGGG - Intergenic
1157332579 18:46714444-46714466 AAGAAGGAGAAGAGGGAGAATGG + Intronic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157562584 18:48659348-48659370 ATGGAGGAGAGCAGTGGGCAAGG - Intronic
1157563791 18:48666194-48666216 AAGGGAGACAAGAGTGAGCAGGG - Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157911640 18:51622593-51622615 CTGGTGGAGAAGGGTGAGTAGGG + Intergenic
1158405008 18:57153108-57153130 ACGAAGGAGAAGAGTGGGCAAGG - Intergenic
1159307967 18:66670242-66670264 AGGGAGGAGAAAAGCGAGCGGGG - Intergenic
1159504967 18:69324743-69324765 GAGGAGGAGAAGAGGGAACAAGG + Intergenic
1159935386 18:74361517-74361539 ATGGAGGAGACGAGTGTCCGAGG + Intergenic
1160013456 18:75123932-75123954 TTGGAGGAAAAGAGGAAGCAAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160123525 18:76150942-76150964 AGGGAGGAGAGGAGTGAGTGGGG + Intergenic
1160223527 18:76994063-76994085 ATGGAGGAGAAGAACGTACAAGG - Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160526739 18:79543030-79543052 ATGGAGGGGAAGGGAGGGCAAGG + Intergenic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160969507 19:1761341-1761363 AAGGAGGAGAAGGCTGGGCACGG - Intronic
1162526940 19:11211673-11211695 AAGGAGGTGAGGAGGGAGCAGGG - Intronic
1164439217 19:28259285-28259307 ATGCAGATGAACAGTGAGCACGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1164769107 19:30794741-30794763 AGAGAGGAGAAGAGTTAGGAGGG - Intergenic
1165390255 19:35534561-35534583 GTGGAGGGGAAGAGAGTGCAAGG + Intronic
1166064751 19:40350935-40350957 TTGAAGGAGAAGAGAGAGTAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166786848 19:45372658-45372680 ATGGATGAGAGAAGTGAGAAAGG + Intergenic
1167195099 19:48023116-48023138 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167446838 19:49542883-49542905 AGGGAGGAAAAGAGAGGGCACGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167724017 19:51198994-51199016 TTTGAGGAGAAGATGGAGCAGGG - Intergenic
1168265007 19:55218019-55218041 ATGGAGGACAAGGGAGAACACGG - Intergenic
925443480 2:3908141-3908163 ATGCAAGAGATGGGTGAGCATGG + Intergenic
925777286 2:7347725-7347747 AAGGAGGAGAAGAGAGTGAAAGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925857075 2:8139540-8139562 GGGGAGGAGAGCAGTGAGCAGGG + Intergenic
926133542 2:10320430-10320452 CTGGAGCAGAAGGGAGAGCAGGG - Intronic
926835349 2:17013084-17013106 ATGGGAGAGATAAGTGAGCAAGG + Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928248881 2:29657181-29657203 AAGGTGGACAAGAGTGAGAAGGG + Intronic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929895157 2:45953422-45953444 AGGGAGGAAGAGAGAGAGCAAGG - Intronic
930953825 2:57178731-57178753 AGACAGGAGAAGAGTGAGAATGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
932822079 2:74909989-74910011 ATCGAGAAAAAGAGTGAGAAAGG - Intergenic
933383116 2:81576328-81576350 ATTGAGAACAAGAGTCAGCATGG + Intergenic
934095502 2:88598925-88598947 ATGGGGGAGAAGAGTGAGAGTGG + Intronic
935511456 2:103981136-103981158 ATGGAGGACAAGAGTTATCTTGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
936370451 2:111898507-111898529 CTGGAGGAGAGGAGCGGGCAGGG - Exonic
937324430 2:120981829-120981851 AAGGAGGAAAGGAGGGAGCAAGG - Intronic
937972854 2:127564099-127564121 AGGGAGGGGAAGAGAGAGCGGGG + Intronic
938105783 2:128528874-128528896 TGGGAGGGGAAGAGTGAGCTTGG + Intergenic
938402893 2:131007316-131007338 ATGGAGGAGAGGAGAGGACAGGG - Intronic
938546940 2:132342165-132342187 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
938719116 2:134049811-134049833 ATGGAGCAGAATAGGGAGCCCGG + Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939894506 2:147775494-147775516 ATCTAGGAGAAGAATGATCAGGG + Intergenic
940075852 2:149741345-149741367 ATGGAGGAGAATGCTGGGCACGG - Intergenic
940682362 2:156803318-156803340 ATGGAGGAGTAGAGGGGGCGGGG - Intergenic
941160530 2:162029683-162029705 ATCCAGGAGCAGAGAGAGCAGGG + Intronic
941228859 2:162883805-162883827 ATGGAGGAGGAGAGAAAGAAAGG - Intergenic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941862782 2:170301512-170301534 ATGTAGTAGAAGAGTGTGAATGG - Intronic
941879872 2:170470244-170470266 ATTGAGGAGAAAAGGGAGAATGG - Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
944073217 2:195696114-195696136 ATGGAATAGAAGAGAGAGCCTGG - Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944573702 2:201071310-201071332 AGGGAGGAGAGGCGGGAGCAAGG - Intronic
944972287 2:205007153-205007175 AGGAAGGAGAAGAGCAAGCAGGG - Intronic
945180166 2:207083564-207083586 ATTGAGGAGAAGAGAGAACTGGG + Intronic
945271530 2:207945291-207945313 ATAGAGGAGAAAAGTGAGCACGG - Intronic
946263816 2:218521058-218521080 AAGGAGGAAGAGAGTGAGAAGGG - Intronic
946361706 2:219222900-219222922 AAGGAAGAGCAGAGTAAGCAGGG + Intronic
946401657 2:219471744-219471766 AGGGAGGAGGCGAGTGGGCAAGG - Intronic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
947042771 2:225942474-225942496 AAGGAGGGGAAGAGGGAGAAGGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948745139 2:240085656-240085678 ATGAAGGAGAAAAGTAAGAAGGG + Intergenic
1168899979 20:1355143-1355165 GAGGAGGAGAAGAGTAAACAGGG - Intronic
1169782436 20:9323906-9323928 AGAGAGGAGAGGAGGGAGCAGGG - Intronic
1169990549 20:11498291-11498313 AGGGAGGAAAAGAGAGAGGAAGG + Intergenic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170061812 20:12266791-12266813 AAGGGGAAGAAGAGAGAGCAGGG + Intergenic
1170310552 20:14986723-14986745 ATGGGGGAGGAGAGTGATCAGGG + Intronic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1171875805 20:30574898-30574920 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
1173148530 20:40546086-40546108 AAGGAGGAGAAGGGGGAGCCAGG + Intergenic
1173192563 20:40887502-40887524 ATCGAGGGGCAGAGGGAGCAGGG - Intergenic
1173754319 20:45501681-45501703 ATGGAGGAAAAGAGGGACCTGGG - Intergenic
1173905579 20:46626285-46626307 AGGGAGGAGGAGAGAGAGAAAGG - Intronic
1174034520 20:47660162-47660184 ATGGAGGAGTAAGGTGAACAAGG - Intronic
1174847619 20:53958418-53958440 AGGGAGGAGTATAGAGAGCAGGG + Intronic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175146377 20:56899540-56899562 AGGAAGGAGAAGAGGAAGCAAGG + Intergenic
1175387464 20:58606350-58606372 AAGGAGCAGAAGACGGAGCATGG + Intergenic
1175781126 20:61682614-61682636 AGGGAGGAGAGGAGAGAACAGGG + Intronic
1176057161 20:63154883-63154905 AGGGATGAGAAGAGGGAGAAGGG - Intergenic
1176787215 21:13271419-13271441 TTGAAGGGGAAGAGTAAGCAAGG + Intergenic
1176840180 21:13834727-13834749 ATGGTGCAGTAGAGTGATCATGG + Intergenic
1177531836 21:22370820-22370842 AGGAAGGAGAAGAGAAAGCAGGG + Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1178060837 21:28851745-28851767 ATGGAAGGGAAAAGTGATCAAGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1179170100 21:38966321-38966343 ATAGGGGAGAAGAGTGAGACTGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181930120 22:26394204-26394226 ATGAAGGTAAAGGGTGAGCATGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182667634 22:31971062-31971084 ATGGAGGAGGCGTGTGAGCCGGG - Intergenic
1182802192 22:33040769-33040791 ATGAAGGAGAAGTGCAAGCAGGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183157290 22:36085196-36085218 GTGGAGGATAAGAGGGTGCAGGG + Intergenic
1183327635 22:37203079-37203101 GAGGAGGAGAGGAGTGGGCAAGG + Intergenic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184318619 22:43720634-43720656 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1184365858 22:44050896-44050918 AAGGAGGAGAAGAGTGGGTGGGG + Intronic
1184877061 22:47282696-47282718 AGGGAGGGGAAGAGTGAGCCTGG - Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
949742799 3:7255659-7255681 ATGGAGGAGAGAAGTGAGTTGGG + Intronic
950005427 3:9688232-9688254 ATGGAGGACAAGAGTCAGCTTGG - Intronic
950182420 3:10925055-10925077 ACGGAGGCGAAGAGACAGCAAGG + Intronic
950190692 3:10974317-10974339 AAGGAAGAGAGGAGGGAGCATGG - Intergenic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950964808 3:17138785-17138807 GAGGAGGAGAAGACAGAGCAGGG + Intergenic
952576778 3:34783532-34783554 ATGGAGGAGGAGGGGGAGCCTGG - Intergenic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
954373865 3:50184190-50184212 AGGAAGGAGGAGAGTGAGCCTGG + Intronic
954940557 3:54368484-54368506 AAAGAGCAGGAGAGTGAGCACGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955496051 3:59533788-59533810 ATGGAGGAGAAGGGAGATTACGG - Intergenic
955581178 3:60424674-60424696 ATGTAGCTGAAGAGTCAGCAGGG + Intronic
955853168 3:63243032-63243054 ATGGAAGAGAAGAAAAAGCAAGG + Intronic
955856481 3:63278504-63278526 GTGGATGAGAAGAGCGAGCGAGG + Exonic
956221415 3:66907841-66907863 ATAGAGGATAAGGTTGAGCAAGG - Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
957199841 3:77119102-77119124 TGGCAGGAGAAGAGAGAGCAAGG - Intronic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958513869 3:95086881-95086903 ATGGAGGTGAAGTGGGAGGAAGG - Intergenic
959869502 3:111310388-111310410 ATGAGGGAAAAGAGTGAGTATGG + Intronic
960015157 3:112878899-112878921 ATGGAGGAGAAGTGGGAAAATGG - Intergenic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
961279476 3:125754672-125754694 AGGGAGGGGCACAGTGAGCAGGG - Intergenic
961874919 3:130014946-130014968 AGGGAAGAGCAGAGTGAGCAGGG + Intergenic
962279258 3:134037891-134037913 AGGGAGGAGATGGGAGAGCAGGG - Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
962904196 3:139787250-139787272 ATAGAAGAGAAGAGAGAGCCAGG - Intergenic
962933596 3:140059525-140059547 CTTGAGGGGAAGACTGAGCAGGG - Intronic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963794476 3:149617730-149617752 GTGGAGGTTAACAGTGAGCAGGG + Intronic
964580349 3:158227428-158227450 ATGGAGGAAAAGAGAGATGAAGG - Intronic
964886762 3:161492429-161492451 AGGGAGGAAAAGGGAGAGCATGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965799261 3:172474851-172474873 TTGGAAGAAAAGGGTGAGCAAGG + Intergenic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
967225502 3:187287322-187287344 AAGTAGGTGAGGAGTGAGCAGGG - Intronic
967298474 3:187988458-187988480 ATGTAAGAAAAGAGTAAGCAGGG - Intergenic
967834412 3:193948803-193948825 ATGGAGGAGAAAAGACACCAGGG - Intergenic
967869344 3:194217202-194217224 TTGGAGGAGAAGCGGGGGCAGGG + Intergenic
968239925 3:197070087-197070109 ATGGATGAGAAGAGTGCCTATGG - Intronic
969941783 4:10739335-10739357 GTGGAGCAGGAGAGAGAGCAAGG - Intergenic
969993743 4:11290802-11290824 CTGGAAGAGATGCGTGAGCAGGG + Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970882306 4:20946426-20946448 ATGCAGAAGACGAGTTAGCAAGG + Intronic
970905299 4:21208886-21208908 AGGAAGGAGAAGAGCAAGCAGGG + Intronic
971410816 4:26369872-26369894 TGGGAGGAGAAGAGAGAGAAAGG - Intronic
972580617 4:40392782-40392804 AGGGATGAGAAGAGAGAACAAGG + Intergenic
972796743 4:42428822-42428844 CCTGAGGACAAGAGTGAGCATGG - Intronic
973345007 4:49046005-49046027 ATGGGGGAGAACAGGGAGAAGGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973788322 4:54355735-54355757 ATGCTGGAGAAGAATGATCAAGG + Intergenic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975208629 4:71673003-71673025 GTGAAGGACAAGATTGAGCAGGG - Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
975431341 4:74294857-74294879 ATAGGGGAGAAGAGAGAACACGG + Intronic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
976401175 4:84608768-84608790 ATGGAGGGGAAGAACGAGCCAGG - Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977899895 4:102407966-102407988 ATGGAGGGGAAGGGTGGGAATGG + Intronic
978063061 4:104362577-104362599 ATGGAAGAGAAAATTGAGTATGG + Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978570960 4:110136830-110136852 AAGTAGGGGAAGAGTGAGAAAGG + Intronic
978821294 4:112969536-112969558 AGGGAGGAAAAGAGTGAAAAGGG + Intronic
979457727 4:120945151-120945173 TTGGAGGAGAAGAGTCATCCTGG - Intergenic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
979960209 4:127009928-127009950 ATGAAGGAGAAGAGAGAGAGCGG + Intergenic
980886937 4:138773146-138773168 ATGGAGGGGAGGAGTGGGAATGG - Intergenic
980929890 4:139176004-139176026 ATGGAGCAGAAGAGAGGGCTCGG + Intronic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983388497 4:167098194-167098216 GTGGAGGGGAAGAGTAATCATGG - Intronic
984044084 4:174776005-174776027 AAGGAGGTGGAGAGTGAGAAGGG + Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984930987 4:184846916-184846938 ATGGAGCAGAAGAGGTTGCATGG - Intergenic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985895929 5:2750160-2750182 AGGGAGGGGAAGAGGGAGTAGGG - Intronic
986088934 5:4482593-4482615 ATGGAGGGGAACAGTCAGGAAGG + Intergenic
986409932 5:7467317-7467339 GTGTAGGAGAAGAGGGAGCTTGG - Intronic
986487668 5:8255540-8255562 ATTCAGGTGAAGAGTGGGCAAGG + Intergenic
986703890 5:10439644-10439666 ATGGAAAAGGAGAGAGAGCAGGG - Exonic
986849122 5:11790391-11790413 ATAGAGGTGTAGATTGAGCATGG + Intronic
987470276 5:18319468-18319490 TTTGAGGAGAAGAGTGAGATAGG + Intergenic
987767583 5:22253696-22253718 GTGGAGGAGAAGAGGGAAAAGGG - Intronic
988680628 5:33480999-33481021 ATGAAGGAGAAGAGGGATGAAGG - Intergenic
990836439 5:60026835-60026857 ATGAAATTGAAGAGTGAGCACGG - Intronic
990946717 5:61256762-61256784 AAGGTGGAGAAGGGTGAGAAGGG + Intergenic
991507245 5:67338093-67338115 TAGGTAGAGAAGAGTGAGCATGG - Intergenic
991557930 5:67916647-67916669 ATGGAAGAGAAGAGTGAGATGGG - Intergenic
992368450 5:76116988-76117010 ATGGAGAGGAAAAGTGAGCTAGG + Intronic
992425183 5:76649758-76649780 ATGGAGGAGAAGTGTGGGGTTGG - Intronic
992645382 5:78806927-78806949 AGGGAGCGGAAGAGTAAGCATGG - Intronic
992794842 5:80246143-80246165 GTGGAGGAGATCAATGAGCATGG + Intronic
993477526 5:88383444-88383466 AGGTAGGAGAAGAGTGACCAAGG - Intergenic
993778756 5:92038704-92038726 ATGGAGGAGAAGATTTAGGCAGG + Intergenic
993930098 5:93927366-93927388 ATGCTGGGGAAGAATGAGCAAGG - Intronic
994296049 5:98089686-98089708 ATGGAGGTGAAGGGGAAGCAAGG + Intergenic
995245502 5:109930897-109930919 AAGGTGGAGAGGAGTGATCATGG - Intergenic
996128914 5:119757409-119757431 ATGGAAAAGTAGAGTGAGCCAGG + Intergenic
996715622 5:126585457-126585479 CTTGGGGAGAAGAGAGAGCAAGG - Intronic
996981584 5:129502194-129502216 AAGGAGGAGAAAAGTGGGCAAGG + Intronic
997459636 5:134043120-134043142 TGGCAGGAGAAGAGTGATCAAGG + Intergenic
997660724 5:135587580-135587602 ATGGAGGAGAACAGGGTCCAAGG + Intergenic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998038647 5:138937114-138937136 ATGGAGGAGCCCAGGGAGCAAGG - Intergenic
998367141 5:141638878-141638900 AGGTTGGAGAAGAGGGAGCAAGG - Intronic
999075865 5:148794733-148794755 AGTGAGAAGAAGTGTGAGCACGG + Intergenic
999197806 5:149794650-149794672 AGGCAGGAGAAGGGTGGGCAAGG + Intronic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1000067641 5:157708872-157708894 AAGGATGAGAAGAGGGAGAAAGG + Intergenic
1000990707 5:167908543-167908565 AGAGAGGAGAAGAGAGGGCAGGG - Intronic
1001240975 5:170069605-170069627 AAGGAGGAGAAGTGGGAGTAGGG - Intronic
1001626010 5:173133088-173133110 TTGGAAGAGAAGAGGGAGAAAGG - Intronic
1001683961 5:173578578-173578600 ATGGGGGTGAAGAGTGCTCAAGG - Intergenic
1002077001 5:176714250-176714272 AAGGAGGAGATGAGTCAGGAAGG - Intergenic
1002337623 5:178491143-178491165 TAGGAGGAGAAGAGAGAGAAAGG + Intronic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1002872899 6:1183406-1183428 CTGGAGGAGCCGAGTGTGCAGGG + Intergenic
1002882564 6:1265854-1265876 ATGAAGGGGAAGAAGGAGCAAGG + Intergenic
1002934982 6:1663750-1663772 ATGAAGGAAATGAGGGAGCAGGG - Intronic
1003686247 6:8305726-8305748 ATGGGGGAGAATAGGGAGAAGGG - Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004029494 6:11852449-11852471 GTGGAGGAGAGGAGGGAGCAGGG + Intergenic
1005529339 6:26687088-26687110 AAGGAGGAGAAAAGGGAACAAGG - Intergenic
1005531682 6:26713496-26713518 AGGGAGGAGAAAAGGGAACAAGG - Intergenic
1005539113 6:26788169-26788191 AGGGAGGAGAAAAGGGAACAAGG + Intergenic
1005541457 6:26814558-26814580 AAGGAGGAGAAAAGGGAACAAGG + Intergenic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005926852 6:30451845-30451867 AGGGAGGTGGAGAGCGAGCATGG - Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1006301627 6:33196474-33196496 GTGGAACAGAAGAGTGACCAGGG - Exonic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006510201 6:34517322-34517344 ATGGTGGGGCAGAGTGGGCAGGG - Intronic
1006514659 6:34539240-34539262 AACAAGGAGAAGGGTGAGCAGGG - Exonic
1006713555 6:36097616-36097638 ATGGAAGAGAAGACTAAGAAAGG - Intronic
1006874674 6:37285077-37285099 AGGGAGGAGAAGAGTAGGCCAGG + Intronic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007155132 6:39735391-39735413 ATGGGGGAGAAGAGAGGTCAGGG - Intergenic
1007186729 6:39978071-39978093 ATGAAGTAAAAGAGTGAGCCAGG - Intergenic
1007478862 6:42136915-42136937 GGGGAGGAGCAGAGTGAACAGGG + Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007955682 6:45915855-45915877 ATGGAGGAGATGGCTGACCAGGG + Intronic
1008537595 6:52518577-52518599 AGGCAGGAGAAGAGAGAGGAAGG + Intronic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009009947 6:57830395-57830417 AGGGAGGAGAAAAGGGAACAAGG + Intergenic
1009012263 6:57856620-57856642 AAGGAGGAGAAAAGGGAACAAGG + Intergenic
1009024657 6:57984225-57984247 ATCCAGGCGAAGACTGAGCAAGG + Intergenic
1009195369 6:60678327-60678349 AGGAAGGAGAAGAGTGGGCAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010335256 6:74674039-74674061 AGAGAGGAGAAGAGAGAGGAAGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011533206 6:88347502-88347524 TTTGATGAGAAGAATGAGCAGGG + Intergenic
1011789518 6:90883594-90883616 ATGGACAACAAAAGTGAGCAGGG - Intergenic
1012286079 6:97390339-97390361 AGGGTGGAGAAGATTCAGCATGG + Intergenic
1012417820 6:99028667-99028689 ATGGGAGAGAAGAGATAGCAGGG - Intergenic
1012975170 6:105772944-105772966 GTGGAGGAGAGTAGTGAGGATGG + Intergenic
1013016285 6:106163501-106163523 CTGGAGGAAAGGAGTGAGCCAGG - Intergenic
1013049091 6:106514215-106514237 AGGGAGCAGAAGTGTGAGAAGGG - Intronic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1014540699 6:122672202-122672224 AAGGAGGAGAAGAGTAGGGAAGG + Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014700651 6:124683555-124683577 ATAGAGGAGAAGATTCTGCAAGG + Intronic
1015355184 6:132269602-132269624 ATGGAGGAGATGGGTAAGCTAGG + Intergenic
1015576097 6:134672717-134672739 ATAGATGAGAAGATTGGGCATGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017589457 6:155962664-155962686 ATGGTGTGGAAGAGTGAACAGGG + Intergenic
1017858319 6:158371270-158371292 ACGGAGGAGAACTGGGAGCATGG + Intronic
1018561034 6:165101093-165101115 ATGGGGGAGAAGAGTAATCCAGG - Intergenic
1018833881 6:167468950-167468972 ATGGAGGCGAAGATTGAAAAAGG - Intergenic
1018990724 6:168671543-168671565 ATGACGGAGAAGAGGGACCAGGG - Intronic
1019973850 7:4564041-4564063 GTGGAGGAAGAGAGTGTGCAGGG - Intergenic
1021035134 7:15788687-15788709 AGGAGAGAGAAGAGTGAGCAGGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022639213 7:32165556-32165578 AGGAAAGAGAAGAGTAAGCAGGG + Intronic
1023047892 7:36227538-36227560 ATAGAGGAGGAAAGTAAGCATGG + Intronic
1023088939 7:36600204-36600226 AGGGAGGAGAGGAGGGAGGAAGG - Intronic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1023527667 7:41121784-41121806 ACGGAGGAGATGGGTGAGAATGG - Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1023756546 7:43423613-43423635 ATGGAGGAATAGAGTGAGCTGGG + Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024180115 7:46883876-46883898 GTGGAGCAGTAGAGTGATCATGG + Intergenic
1024603403 7:51006561-51006583 AGGCAGGAGAAGAGAGAGGATGG + Intergenic
1025218615 7:57083693-57083715 ATGGAGTAGAAGAGTAAGTTTGG + Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1026223791 7:68423155-68423177 ATGGGGGAGAAGAGAGAGGTGGG + Intergenic
1026346573 7:69479713-69479735 ATGGAGGACAAAATAGAGCAAGG + Intergenic
1026517105 7:71082439-71082461 ATGGTGAAGAAGAGTAACCAAGG - Intergenic
1027736315 7:81937069-81937091 AAGGAGGAGTAGGGTGAGCCTGG - Intergenic
1028950989 7:96634783-96634805 ATGGTGGAGAAGAGTAGGCAAGG + Intronic
1029212793 7:98922509-98922531 AGGGAGCAGAAAAGTCAGCAGGG - Intronic
1029905905 7:104093284-104093306 AGGGAGGAGAAGTGAGAGAAAGG - Intergenic
1030497318 7:110315974-110315996 ATGGGGGAGGGTAGTGAGCATGG - Intergenic
1030523828 7:110629953-110629975 AAGGAGAAGAAGAGAGAGCTGGG - Intergenic
1031003856 7:116449892-116449914 ATGTAGGAGAAGATGGGGCAAGG + Intronic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1032333897 7:131006596-131006618 AAGGAGGAGAAAAGGGGGCAAGG + Intergenic
1032348033 7:131135065-131135087 AAGGAGGAGATGAGTTGGCAAGG - Intronic
1032429638 7:131850148-131850170 GTGGAGGAGAGGAGAGAGCTTGG + Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032663509 7:134012040-134012062 ATGGATGAAGTGAGTGAGCAGGG + Intronic
1032991582 7:137400376-137400398 ATGAAGGAGAAAAGTAAACAAGG - Intronic
1033786882 7:144742715-144742737 ATAGAGGAAAAGAAAGAGCAAGG + Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034483741 7:151343275-151343297 AGGGAGGAGAAAAGAGAGGAAGG - Intronic
1034675452 7:152889776-152889798 ATGGAAGAGAATAGAGAGCCCGG - Intergenic
1034821928 7:154223841-154223863 AGGCAGGAGGGGAGTGAGCATGG + Intronic
1035264633 7:157684423-157684445 GTGGGGGAGGGGAGTGAGCAGGG + Intronic
1035357827 7:158289263-158289285 AAGAAGGAGAAGAGAGACCAAGG - Intronic
1035493083 7:159296772-159296794 GTGGAGGAGAAGAGTAAATATGG + Intergenic
1036678242 8:10852166-10852188 AGGGAAGAGAAGGGTCAGCACGG + Intergenic
1037466832 8:19169152-19169174 ATGGAGGAGAAGAGGAGGAACGG + Intergenic
1037783936 8:21891257-21891279 ATGTAGCAAAAGAGTGAGCCAGG + Intergenic
1037927750 8:22857833-22857855 ATGGAGAAGAACAGGGGGCAAGG + Intronic
1037940110 8:22944847-22944869 AGGAAGGGGAAGGGTGAGCATGG + Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038363041 8:26902006-26902028 GTGGCTGAGGAGAGTGAGCAAGG + Intergenic
1038495497 8:27999327-27999349 ATGGAGGAGGCTAGTGGGCAGGG - Intergenic
1038548042 8:28441220-28441242 GTGGAGGAGGAGAGGGAGTAGGG - Intronic
1038860131 8:31378462-31378484 ATAGAGGATAATAGTGAGAAAGG - Intergenic
1039398356 8:37246863-37246885 ATGGGGGAGAAGAGTGGGAGAGG + Intergenic
1039845966 8:41325607-41325629 TTGGAGGAGGACAGTGAGAAGGG - Intergenic
1039986506 8:42452314-42452336 ATGGAGGAGAAGAAAGAGATAGG + Intronic
1040461521 8:47653492-47653514 ATGAAGGAAAAGAGGGAGCGAGG - Intronic
1040819647 8:51541635-51541657 GTGTAGGAGACCAGTGAGCAGGG - Intronic
1041330518 8:56719304-56719326 AAGGAGGAGGAGAGGGAGCAGGG - Intergenic
1042939848 8:74096563-74096585 ATAGAGCAGGAGAGTCAGCAGGG - Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1044514299 8:93120709-93120731 ATAAAGGAGAAGAGAGATCAGGG - Intergenic
1045040462 8:98219121-98219143 ATGGAAGAGAAGAGAGAGTTTGG + Intronic
1045068346 8:98473742-98473764 ATTTAGGAGAAAAGAGAGCATGG - Intronic
1045610105 8:103829714-103829736 GGGTAGGAGGAGAGTGAGCATGG + Intronic
1046348037 8:112962799-112962821 AAGGAGGAGAATAGGGAGAATGG - Intronic
1046726642 8:117682178-117682200 ATGAAAGAGAGGAGAGAGCATGG + Intergenic
1046756106 8:117974383-117974405 ATGGAGCAGATGAGGAAGCATGG - Intronic
1046833772 8:118776922-118776944 ATAGAGGAGAGGATTGAGAAGGG + Intergenic
1047767780 8:128003332-128003354 AAGGAGGAGAAGGGAGGGCAGGG - Intergenic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1047973308 8:130105735-130105757 ATGGTGGAGTAGAGTGCGCTGGG + Intronic
1048165633 8:132059178-132059200 ATGGAGGAAAAGAGTGAGGGAGG - Intronic
1048224487 8:132571538-132571560 AGGGAGGGGAAGAAGGAGCAGGG + Intergenic
1048815812 8:138332674-138332696 GGGAAGGAGAAGAGTGAACACGG + Intronic
1049102219 8:140588009-140588031 ATGGAGGAGATGGGGGAGGATGG - Intronic
1049761749 8:144334775-144334797 ATGGAGGAGCAGGGAGGGCAGGG - Intronic
1049954797 9:682646-682668 AAGGAGGAGAAAAATGACCAGGG - Intronic
1050447611 9:5742112-5742134 ATGTAGGAAAAGAATTAGCAAGG - Intronic
1050785398 9:9394850-9394872 AAGGAGGAGTAGAGTGGGCAGGG - Intronic
1050858319 9:10391002-10391024 ATGGAGGAGAACACTCACCATGG + Intronic
1051545376 9:18268479-18268501 ATTTAGGAGAAGAAGGAGCAGGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052064463 9:23999879-23999901 ATGGAAGAGAACAGAGAACACGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1052971966 9:34382038-34382060 AAGGAGGAGAAGGTGGAGCAGGG + Intronic
1053072801 9:35111177-35111199 GGGGAGGAGAGGAGTGAGAAGGG - Exonic
1053290855 9:36878907-36878929 ATGCATGAGAAGAGACAGCAAGG + Intronic
1054996634 9:71398573-71398595 GTGGAGCAGAAGAGAGAGCTGGG - Intronic
1055262081 9:74448912-74448934 ATGGAAGGGATGAGTTAGCATGG - Intergenic
1055468513 9:76589037-76589059 ATAGAGCAAAAGAATGAGCATGG + Intergenic
1057050439 9:91919713-91919735 ATGAAGGAGCAGAGTGGGCTGGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057240067 9:93400099-93400121 ATGGGGGAGGACAGTGGGCAGGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057901796 9:98954917-98954939 ATGAAGGAGAAGAGTGGAGAGGG - Intronic
1057984073 9:99691719-99691741 TTGGAAGAGAAGCCTGAGCAAGG + Intergenic
1058209045 9:102144508-102144530 ATGGACTAGCACAGTGAGCAAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058816990 9:108693620-108693642 ATAGAGGTCAGGAGTGAGCAAGG + Intergenic
1058937878 9:109785894-109785916 TGGGAGGAGAGGAGTGAGCTTGG + Intronic
1059550668 9:115225706-115225728 AGGGAGGAGAAGAGTGAAAATGG + Intronic
1059885104 9:118736923-118736945 ATGGAGGAGAAATGTGAGCTTGG + Intergenic
1060293178 9:122323189-122323211 AAGGAGGGGAAGAGAGAGCCAGG - Exonic
1060852433 9:126888878-126888900 ATGGAGTAGAACAGAGAGCAGGG - Intergenic
1060868114 9:127015932-127015954 AAGGAGGAGAAGGGAGAGAAAGG - Intronic
1061996662 9:134189674-134189696 AGGGAGGTGAAAAGAGAGCAAGG + Intergenic
1062255761 9:135619944-135619966 ATGGGGGAGAAGGGGGAGAAGGG - Intergenic
1062255872 9:135620219-135620241 ATGGGGGAGAAGGGGGAGTAGGG - Intergenic
1062255900 9:135620291-135620313 ACGGGGGAGAAGAGGGAGTAGGG - Intergenic
1186047110 X:5548566-5548588 AAGGAGGAGAAGATAGAGAAAGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186435026 X:9535348-9535370 ATGGAGGTGAAGAGTGTGTGTGG + Intronic
1186482124 X:9904030-9904052 AAGGAGGAGAAGCGGGAGCAGGG + Intronic
1186602387 X:11051685-11051707 AGGGAAGAGAAGAGTGGACAGGG - Intergenic
1186777705 X:12882308-12882330 ATAGAGGAGAAGGGGGAGCAGGG + Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1189106163 X:38237895-38237917 ATGTAGGAGAATAGTGAGAGAGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1192072669 X:67957752-67957774 ATGGAGGAGAATAATGAGCCAGG - Intergenic
1192266200 X:69539544-69539566 ACAGAGGAGAAGAGGGAACAAGG - Intergenic
1192450942 X:71244471-71244493 CTGGAGGGGAAGAGAAAGCAGGG + Intronic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1193139802 X:78016174-78016196 GTGGAGGAGAAGGGGAAGCAAGG + Intronic
1193738747 X:85192390-85192412 ATGGAGGGGAAGAGAAGGCATGG - Intergenic
1194087952 X:89552256-89552278 AAGAGAGAGAAGAGTGAGCAAGG + Intergenic
1194596563 X:95866318-95866340 ATGGAAACCAAGAGTGAGCAGGG + Intergenic
1195989524 X:110668669-110668691 GGTGAGGAGAGGAGTGAGCAGGG - Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1197560093 X:128010489-128010511 ATGGAAGAGAAAAGTAAGAAGGG + Intergenic
1197671387 X:129282184-129282206 ATGGAGAGCAAAAGTGAGCAGGG - Intergenic
1197680141 X:129374157-129374179 AGGGAGGCAAAGAGTGAACATGG - Intergenic
1198013557 X:132585222-132585244 ATGGAGGAGAAGATTAAAGAGGG - Intergenic
1198311809 X:135432470-135432492 ATGAAGGAGAAGGGAGAGAAAGG - Intergenic
1199612788 X:149631932-149631954 ATGGAGGCTGGGAGTGAGCAGGG + Intergenic
1199758975 X:150890813-150890835 CTGGAGGAGAAGGGTGGGAAAGG + Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200440668 Y:3208545-3208567 AAGAGAGAGAAGAGTGAGCAAGG - Intergenic
1200690298 Y:6302178-6302200 CCTGAGGAGAAAAGTGAGCAAGG + Intergenic
1201044975 Y:9872538-9872560 CCTGAGGAGAAAAGTGAGCAAGG - Intergenic
1201341811 Y:12942355-12942377 ATGGAAGAGGAGAGTGGCCAGGG + Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1202578296 Y:26350879-26350901 GGGGAGGAGAAGAGGGAGTATGG - Intergenic