ID: 978488030

View in Genome Browser
Species Human (GRCh38)
Location 4:109278175-109278197
Sequence CTGAATCAGCATATCTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978488029_978488030 24 Left 978488029 4:109278128-109278150 CCATCTCAAAAAAAAAAAAGAAG 0: 271
1: 10111
2: 101558
3: 76320
4: 94041
Right 978488030 4:109278175-109278197 CTGAATCAGCATATCTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978488030 Original CRISPR CTGAATCAGCATATCTATTC AGG Intronic
No off target data available for this crispr