ID: 978490374

View in Genome Browser
Species Human (GRCh38)
Location 4:109305280-109305302
Sequence CTTGATGCAGAGAGTCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978490374_978490376 11 Left 978490374 4:109305280-109305302 CCTGGTAGACTCTCTGCATCAAG No data
Right 978490376 4:109305314-109305336 TGTGGATCAACAAAGCTCTGAGG No data
978490374_978490375 -7 Left 978490374 4:109305280-109305302 CCTGGTAGACTCTCTGCATCAAG No data
Right 978490375 4:109305296-109305318 CATCAAGCACAGAGAACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978490374 Original CRISPR CTTGATGCAGAGAGTCTACC AGG (reversed) Intergenic
No off target data available for this crispr