ID: 978497636

View in Genome Browser
Species Human (GRCh38)
Location 4:109377320-109377342
Sequence CTGTGAGTATGTAGAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978497632_978497636 20 Left 978497632 4:109377277-109377299 CCTTGTTCATTCTTCCATTCAAC No data
Right 978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG No data
978497633_978497636 6 Left 978497633 4:109377291-109377313 CCATTCAACAAGTATCTGTCATG No data
Right 978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG No data
978497631_978497636 25 Left 978497631 4:109377272-109377294 CCTGACCTTGTTCATTCTTCCAT No data
Right 978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978497636 Original CRISPR CTGTGAGTATGTAGAGAGAT GGG Intergenic
No off target data available for this crispr