ID: 978498067

View in Genome Browser
Species Human (GRCh38)
Location 4:109381044-109381066
Sequence GCTGGAAAGCTGCCAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978498064_978498067 21 Left 978498064 4:109381000-109381022 CCTGTTTTGTGCAGCAGAACTTG No data
Right 978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978498067 Original CRISPR GCTGGAAAGCTGCCAGTCAC AGG Intergenic
No off target data available for this crispr