ID: 978499772

View in Genome Browser
Species Human (GRCh38)
Location 4:109396765-109396787
Sequence GAGAAATCTCACCATTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978499772_978499778 25 Left 978499772 4:109396765-109396787 CCACAGAAATGGTGAGATTTCTC No data
Right 978499778 4:109396813-109396835 TGTAATCCTAGCACTTTGAAAGG No data
978499772_978499775 -6 Left 978499772 4:109396765-109396787 CCACAGAAATGGTGAGATTTCTC No data
Right 978499775 4:109396782-109396804 TTTCTCTTGGCCAGGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978499772 Original CRISPR GAGAAATCTCACCATTTCTG TGG (reversed) Intergenic