ID: 978503500

View in Genome Browser
Species Human (GRCh38)
Location 4:109433669-109433691
Sequence CAGGATCCCCGCGCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978503485_978503500 28 Left 978503485 4:109433618-109433640 CCCAGGTGTAAGTCCCGGGGCGT 0: 1
1: 0
2: 0
3: 0
4: 45
Right 978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 118
978503484_978503500 29 Left 978503484 4:109433617-109433639 CCCCAGGTGTAAGTCCCGGGGCG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 118
978503493_978503500 14 Left 978503493 4:109433632-109433654 CCGGGGCGTGGGGCGCGTGGGTC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 118
978503486_978503500 27 Left 978503486 4:109433619-109433641 CCAGGTGTAAGTCCCGGGGCGTG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 118
978503492_978503500 15 Left 978503492 4:109433631-109433653 CCCGGGGCGTGGGGCGCGTGGGT 0: 1
1: 0
2: 1
3: 15
4: 193
Right 978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978503500 Original CRISPR CAGGATCCCCGCGCCCGCGG CGG Intergenic
901279897 1:8026070-8026092 CTGGATCCCGGCGCCCGGCGCGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903581213 1:24372463-24372485 CAGGATCCCCCCACCCCGGGAGG + Intronic
904778261 1:32925101-32925123 CAGGAGTCAGGCGCCCGCGGGGG + Intergenic
914790944 1:150876729-150876751 CAGCATCCCAGCCCCTGCGGCGG + Exonic
921923407 1:220691914-220691936 CTGGCTCCCCCCGCCCCCGGGGG + Intronic
923623105 1:235593939-235593961 CAGGCTGCCCGCGCCAGCTGGGG - Intronic
1064354387 10:14604277-14604299 CTCGCTCCCGGCGCCCGCGGCGG + Intronic
1066661028 10:37738276-37738298 CAGGCTCCCTGCACCAGCGGTGG + Intergenic
1072891517 10:99329384-99329406 CAGGATGGCGGCGGCCGCGGCGG + Exonic
1077178049 11:1199499-1199521 CAGGATCCCCGCTCCAGCCAAGG + Intronic
1079071547 11:17351989-17352011 CAGGAGCGCCGCGCACGTGGAGG - Exonic
1084028460 11:66467072-66467094 CACGCCCCCCGCGCCCGCCGGGG - Intronic
1084792414 11:71482905-71482927 CAGGATCCCCGAGACCTCTGTGG + Exonic
1089243126 11:117098433-117098455 CCGGCTCCCCGCGGCCCCGGAGG - Exonic
1090068654 11:123525410-123525432 CAGGTTCCCCTCCCCCGCAGGGG + Intergenic
1090558013 11:127897980-127898002 CAGGCTGCCCGCACCAGCGGTGG - Intergenic
1090782845 11:130022415-130022437 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
1091201347 11:133783213-133783235 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
1092834100 12:12472034-12472056 CAGGCTGCCCGAGCCAGCGGTGG - Intergenic
1095687294 12:45050706-45050728 CCGGAGCTGCGCGCCCGCGGTGG + Exonic
1101254716 12:102965756-102965778 CAAGCTTCCCGGGCCCGCGGGGG - Intergenic
1102232722 12:111274725-111274747 CAGGCTCCGGGCGCCTGCGGGGG - Intronic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1108517966 13:51220915-51220937 CAGGTTCCCCTCGCCCACAGGGG - Intergenic
1121734596 14:96209132-96209154 CAGGACCCCCGCACCTGCGTGGG - Intronic
1122126669 14:99582108-99582130 CAGCATCCCCCCGCCCCCGCTGG - Intronic
1123216365 14:106812904-106812926 CAGGAACCCCGCACCCTAGGCGG - Intergenic
1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG + Intronic
1127144082 15:56007187-56007209 CAGGATCCGGGCGGCGGCGGCGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132398238 15:101489581-101489603 CGCGCCCCCCGCGCCCGCGGCGG + Exonic
1132584559 16:700616-700638 CAGGATGCCGGCGCCCGAGGCGG + Intronic
1133013935 16:2930322-2930344 CAGGATCCCCACGCCCTCCCTGG + Intronic
1136163431 16:28436178-28436200 CAGGCTGCCCGCGCCCACAGTGG + Intergenic
1136199532 16:28678809-28678831 CAGGCTGCCCGCGCCCACAGTGG - Intergenic
1136215878 16:28792982-28793004 CAGGCTGCCCGCGCCCACAGTGG - Intergenic
1136873027 16:33825174-33825196 CAGGAACCCCGCACCCTTGGCGG + Intergenic
1142007783 16:87697953-87697975 CAGGACCCCTGTGCCCGGGGAGG + Exonic
1203099145 16_KI270728v1_random:1290881-1290903 CAGGAACCCCGCACCCTTGGCGG - Intergenic
1144753542 17:17666347-17666369 CAGGATCCCCGGGCCCCTGCTGG + Intergenic
1145303583 17:21656999-21657021 CAGGAACCCCGGGCCAGCTGAGG - Intergenic
1148081089 17:44968043-44968065 CAGCATCACCACACCCGCGGCGG + Exonic
1149865703 17:60149961-60149983 CAGGATCGCTGCACCCGCGGCGG + Exonic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150484868 17:65536829-65536851 CATGACCCTCGCGGCCGCGGCGG + Intronic
1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG + Intronic
1152543188 17:80987334-80987356 CAGGCTTCCCCTGCCCGCGGTGG - Intergenic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1158460590 18:57643016-57643038 CAGGCTGCCCGAGCCAGCGGAGG - Intergenic
1159931435 18:74316176-74316198 CAGGATCCCGGTGCCGGCGCCGG + Intronic
1160430734 18:78810892-78810914 CAGAATCGCCGAGCCCCCGGCGG + Intergenic
1160778935 19:869240-869262 CAGGCTCCCCGGGCACGTGGCGG - Intronic
1160992202 19:1864407-1864429 CCGGTATCCCGCGCCCGCGGCGG + Intergenic
1161961860 19:7527719-7527741 CAGGGCCCCCCCGCCCGCGCTGG + Intronic
1163210489 19:15836614-15836636 CAGGATCCCCAGGCCGGAGGCGG + Intergenic
1163320577 19:16572346-16572368 CAGGATGGCGGCGGCCGCGGTGG - Exonic
1163662796 19:18588801-18588823 CATGATCACCGAGACCGCGGCGG + Exonic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1164759766 19:30719948-30719970 CAGGACCCACGCGCCCTCGGCGG - Intergenic
1165808554 19:38596635-38596657 CACGACCCCCGTTCCCGCGGAGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
924958372 2:11160-11182 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958377 2:11189-11211 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958382 2:11218-11240 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958387 2:11247-11269 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958392 2:11276-11298 CAGGCGCACCGCGCCCGCGCAGG + Intergenic
925088566 2:1134265-1134287 CAGGATCCCGGCGCCACCAGTGG - Intronic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
927606608 2:24491650-24491672 CACGAGCCGCGCGGCCGCGGAGG + Intergenic
930038142 2:47100543-47100565 CAGGCTCCCCGAGCCAGCAGTGG + Intronic
930039360 2:47108248-47108270 CAGGCTCCCCGAGCCAGCAGTGG + Intronic
935692620 2:105744889-105744911 GACGATCCCCGCGGCAGCGGCGG - Exonic
938301122 2:130213697-130213719 CAGGATCCCCGCCCCGGCCCCGG + Intergenic
938455594 2:131460770-131460792 CAGGATCCCCGCCCCGGCCCCGG - Intergenic
939629742 2:144517111-144517133 CCGGAGCCCGGCGCGCGCGGCGG - Intronic
942278660 2:174340721-174340743 AAGGTTCCCCGCGCCCCCAGGGG - Intergenic
945140966 2:206685710-206685732 CAGGAGCCCCGTGCCCAGGGTGG - Intronic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
947156052 2:227164168-227164190 CTTGTTCCCCGCGCCCGCGGCGG - Intergenic
947542894 2:230990886-230990908 CACGATCCCCACGAGCGCGGCGG - Intergenic
948765281 2:240216239-240216261 CCGGATCCCCACGCCTGTGGGGG + Intergenic
1171521104 20:25774684-25774706 CAGGAACCCCGGGCCAGCTGAGG - Exonic
1171555822 20:26081795-26081817 CAGGAACCCCGGGCCAGCTGAGG + Intergenic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1176177551 20:63735819-63735841 CAGGAGCCCAGCGCCAGCTGGGG + Exonic
1178695757 21:34792067-34792089 CAGGAGGCCCGCGCGCCCGGAGG + Exonic
1178983227 21:37282737-37282759 CAGGCTGCCCGCGCCAGCAGTGG - Intergenic
1179810056 21:43864860-43864882 CCTGATCCCCGCGCCCCCCGCGG + Intergenic
1183939524 22:41285577-41285599 CAGCAGGCCCACGCCCGCGGGGG - Intronic
1184604224 22:45562999-45563021 CAACATCCAAGCGCCCGCGGTGG + Intronic
1184712901 22:46263372-46263394 CACTATCCCCGCGACCCCGGTGG - Intergenic
954437359 3:50503289-50503311 CCGGGCCCCCGCGCCCGCTGTGG - Exonic
955186548 3:56719783-56719805 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
956684885 3:71816929-71816951 CAGAATCCCCTCCTCCGCGGGGG + Intergenic
960884982 3:122384344-122384366 CAGGATTCCCCCACCCGCAGCGG - Intronic
961451477 3:127004165-127004187 CAGCATCCCAGTGCCCACGGAGG - Intronic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
984296550 4:177861647-177861669 CAGGATCCCTGTGCTCTCGGGGG + Intronic
984793209 4:183633112-183633134 CAGGGTCCCGGGGCCCGTGGTGG + Intergenic
993905736 5:93621293-93621315 CAGGACCCCCGCCCCCTCGCGGG + Intronic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1006520831 6:34570209-34570231 CAGGATCCCCGCGCCCAGTCTGG + Intergenic
1011075280 6:83431435-83431457 CAGGATCCCCCTGCCCGGGAAGG + Intergenic
1016067241 6:139697472-139697494 CAGGCTGCCCGAGCCCGCAGTGG - Intergenic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017738230 6:157381966-157381988 CAGGAGCCCCCCGGCCGCGCGGG - Exonic
1017955076 6:159170260-159170282 CAGGAGGCCCGCGCGCCCGGGGG + Intronic
1018093142 6:160362818-160362840 CAGGAGCCCCGAGCTCGAGGTGG + Intronic
1020278078 7:6636872-6636894 CCAGATCCCCGGGCCCGCGCGGG - Intergenic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1026673767 7:72412338-72412360 CTGGCTCCCCGAGCCCGCTGGGG - Exonic
1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG + Intronic
1043110278 8:76170822-76170844 CAGGCTGCCCGCGCCAGCAGTGG + Intergenic
1056216432 9:84409476-84409498 CAGGCTGCCCGAGCCCGCAGCGG + Intergenic
1056746964 9:89311396-89311418 CTGGGTCGCCCCGCCCGCGGGGG - Intronic
1061559681 9:131394357-131394379 CAGGGCCCCCGGGCCCCCGGCGG - Intronic
1061666626 9:132163675-132163697 CAGGGGCCCCGCGCCCGCCGCGG + Intronic
1062625942 9:137441563-137441585 CAGGGTCGCCCCGCCCCCGGGGG + Intronic
1190055727 X:47180072-47180094 CAGGGTCCCGGCCCCCGGGGTGG + Intronic
1192577518 X:72254998-72255020 CAGGAACCCCGCTCTGGCGGGGG + Intronic
1194412879 X:93578172-93578194 CAGGAACCCAGCGCCCTCAGTGG - Intergenic
1199500573 X:148501529-148501551 CAGGTGCCCAACGCCCGCGGCGG + Intronic
1200163103 X:154019254-154019276 CAGCATCCCTGCACCCGCCGAGG - Exonic