ID: 978503528

View in Genome Browser
Species Human (GRCh38)
Location 4:109433797-109433819
Sequence AAGGGAAGGCGGGGCCGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 629}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978503528_978503538 2 Left 978503528 4:109433797-109433819 CCTCTCCGGCCCCGCCTTCCCTT 0: 1
1: 1
2: 4
3: 48
4: 629
Right 978503538 4:109433822-109433844 CTCCGCCCACCTCCCTGAAGCGG 0: 1
1: 0
2: 1
3: 22
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978503528 Original CRISPR AAGGGAAGGCGGGGCCGGAG AGG (reversed) Exonic
900117215 1:1033846-1033868 AAGGGAACGCCGGGCAGGCGGGG - Intronic
900160475 1:1220880-1220902 CAGGGAACGCGGGACCGGGGTGG + Intronic
900503140 1:3016405-3016427 AAGGGAAGGAGGGGGGAGAGAGG + Intergenic
900503167 1:3016508-3016530 AAGGGAAGGAGGGGGGAGAGAGG + Intergenic
900614445 1:3558513-3558535 AAGGGAAGTCGGGGCAGGAAGGG - Intronic
900983333 1:6058989-6059011 TAGGGAAGCTGGGGCTGGAGAGG - Intronic
901018060 1:6242780-6242802 AAGGGTAGGCGGGGGCGGGCTGG + Intergenic
901137887 1:7009465-7009487 AAGTGAAGAGGGGGCCGGACAGG - Intronic
901265015 1:7903346-7903368 AAAGGAAGGAGGGGAAGGAGGGG - Intergenic
901740342 1:11338077-11338099 AGGGGAAGGAGGGGGAGGAGAGG - Intergenic
902555625 1:17244995-17245017 AAAGGATGACGGGGCAGGAGGGG + Exonic
902671931 1:17980515-17980537 CAGGGAAGGCGGGGCCTGGGGGG + Intergenic
902686213 1:18079315-18079337 AGGGGAGGGCAGGGCAGGAGGGG + Intergenic
902808015 1:18872757-18872779 AAGGGGTGGAGGGGCTGGAGTGG + Exonic
903211070 1:21818918-21818940 GAGGGGAGGCGGGGCCAGGGAGG - Intronic
904259475 1:29280142-29280164 GTGGGAAAGCGGGGACGGAGGGG + Intronic
904319221 1:29685680-29685702 GAAGGAAGGAGGGGCCAGAGGGG - Intergenic
904751124 1:32741935-32741957 CATGGCAGGCGGGGGCGGAGCGG - Exonic
905240955 1:36581133-36581155 AAGGGAAGGCTGGGCTGAACAGG - Intergenic
905289387 1:36911128-36911150 GAGGGAGGGGGTGGCCGGAGGGG + Intronic
905775661 1:40665707-40665729 AAGGGGAGGCGGGGCCTGCCGGG + Intergenic
906142273 1:43540806-43540828 CAGGGAAGGAGGGGCCTGTGGGG - Intronic
906209178 1:44002739-44002761 AAGGGACTCCGGAGCCGGAGAGG - Intronic
907399564 1:54216528-54216550 AAGGGAAGCAGGAGCTGGAGTGG - Intronic
907528200 1:55066565-55066587 CAGGGAAGGTGGGGCAGGACAGG + Exonic
907938275 1:59062204-59062226 AAGGGACTGCGAGGCAGGAGGGG - Intergenic
908252274 1:62274525-62274547 AAGGGGAGGGAGGGCAGGAGGGG + Exonic
908402780 1:63786804-63786826 AAGGAAAGGAGGGGCCCAAGAGG + Intronic
910921005 1:92346972-92346994 AAGAGAAAGCAGGGCTGGAGAGG - Intronic
912318946 1:108692548-108692570 GAGGGAAGGAGGGGGGGGAGGGG - Exonic
912909653 1:113744998-113745020 AAGGGAGGGCAGGGCAGGAGAGG + Intronic
914250065 1:145914720-145914742 AAGGGAAGGCGTCTCCGAAGAGG - Intronic
914437231 1:147670675-147670697 AACGGCTGGCTGGGCCGGAGGGG - Intergenic
914882230 1:151556349-151556371 AAGGGAAGGCAGGGAGGGAAAGG - Intronic
915074864 1:153299620-153299642 AAGGTAAGGTGGGGTGGGAGAGG - Intronic
915465116 1:156092818-156092840 AAGGGAAGGAGGAGCAGGATGGG - Intronic
915564993 1:156708111-156708133 AAGGGAAGTCGGGCTGGGAGAGG + Intergenic
915596501 1:156899459-156899481 AAAGGAAGTGGGGGCAGGAGGGG - Intronic
915704591 1:157831918-157831940 GAGGGCAGGCGGGGCCAGGGGGG + Exonic
916716946 1:167454816-167454838 AAGGGAGGACAGGGGCGGAGGGG + Intronic
916991589 1:170250809-170250831 ATGGGAAGGGGGGGCTGGAGGGG + Intergenic
917816207 1:178712747-178712769 AAGGGGAGGGGGGGAAGGAGAGG + Intergenic
917854321 1:179088931-179088953 TGGGGAAGGCGAGGCCGGAGTGG - Intronic
919788570 1:201275706-201275728 AAGGGAAGTCAAGGCCAGAGAGG - Intergenic
919814331 1:201428219-201428241 AAGGGAACCTGGGGCGGGAGTGG - Intronic
920186674 1:204163667-204163689 ACGGGAAGGTGAGGCCGGTGTGG - Intronic
920387684 1:205580206-205580228 GAGGGAAGGAGGGGAAGGAGAGG - Intronic
920388115 1:205582086-205582108 AAGGGAAGGAGCAGACGGAGAGG - Intronic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
920399726 1:205669398-205669420 AAGGGAAGGGAGGGTCAGAGGGG + Intronic
921138772 1:212285846-212285868 AGGGAAGGGCGGGGGCGGAGGGG - Exonic
921155051 1:212432905-212432927 AAGGCAAGGCCGGGCCAGGGCGG - Exonic
921882640 1:220272193-220272215 AAGGAAGGGCGAGGCCAGAGAGG + Intronic
922032197 1:221812344-221812366 GAGGCAAAGCGGGGCCAGAGTGG - Intergenic
922503038 1:226110573-226110595 TGGGGAAGGCAGGGCCGGCGCGG + Intergenic
922706976 1:227795223-227795245 GAGGGAAGGCGGGGCTGGGGGGG - Intergenic
924815824 1:247441189-247441211 AAGGGAAAGGGGGGGGGGAGGGG - Intronic
1062995104 10:1858265-1858287 AAGGGAAGGAGCCTCCGGAGTGG - Intergenic
1063113071 10:3053487-3053509 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113079 10:3053505-3053527 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113100 10:3053559-3053581 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113108 10:3053577-3053599 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113116 10:3053595-3053617 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113124 10:3053613-3053635 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113145 10:3053667-3053689 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113153 10:3053685-3053707 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113161 10:3053703-3053725 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063220402 10:3961860-3961882 AAGGGAGGGAGGGGCCCGATGGG + Intergenic
1063426136 10:5951491-5951513 AAGTGTAGGTGGGGCGGGAGGGG - Intronic
1063450105 10:6145269-6145291 AAGGAGACGCGAGGCCGGAGGGG - Intronic
1064418337 10:15168975-15168997 GGGGAAAGGCGGGGCTGGAGGGG - Intergenic
1064627230 10:17273821-17273843 AGGGGAAGGCGGGGAGGGGGAGG - Intergenic
1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG + Intronic
1066689336 10:38010893-38010915 AGGGGAAGGCGGGGACGGCGGGG + Intronic
1067282004 10:44880113-44880135 GAGGGAAGGCCGGGTTGGAGGGG - Intergenic
1067807881 10:49405818-49405840 AAGGGAAGGAGGGAGTGGAGGGG - Intergenic
1068261741 10:54592297-54592319 AAGGGAAGGAGGGAGGGGAGGGG - Intronic
1069418449 10:68223859-68223881 AAGGCAAGGCAGGGCAGGATTGG + Intergenic
1069666306 10:70162460-70162482 GAGGGGAGGCGGGGCAGGGGAGG + Intronic
1069807993 10:71137913-71137935 AAGTGAAGGTGGGGCTGGGGTGG + Intergenic
1069896986 10:71686013-71686035 AGGAGGAGGAGGGGCCGGAGGGG + Intronic
1069945032 10:71979597-71979619 AAGGGAAGGCGGTACCGGAAGGG - Intronic
1071456849 10:85857555-85857577 AAGGGAAGGCGGTGAGGGCGAGG + Intronic
1071813259 10:89206629-89206651 AAGGGAAGTTGTAGCCGGAGTGG + Exonic
1072124225 10:92431300-92431322 AAGGGAAGGAAGGGAAGGAGAGG - Intergenic
1072190654 10:93074126-93074148 AAGGGAGGGTGGGGCGGGACAGG + Intronic
1072758718 10:98038499-98038521 AAGGCAAGGCGGGGCGGGGCTGG + Intergenic
1073192270 10:101660071-101660093 AAAGGAAGGAAGGGCGGGAGGGG + Intronic
1073287065 10:102395652-102395674 AAGGGGAGGCGGGGCCGGAGGGG - Intronic
1073809463 10:107136855-107136877 AAAGGAAGCAGGGGACGGAGGGG - Intronic
1073956024 10:108872316-108872338 AAGGGAAGGAGGAGGGGGAGAGG + Intergenic
1074111190 10:110423804-110423826 ACGGGCAGTCGGGGCGGGAGTGG - Intergenic
1074267816 10:111922263-111922285 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
1075265372 10:120996396-120996418 AAGGGATGGTGGGGCGGGGGTGG - Intergenic
1075651465 10:124130331-124130353 AAGGGAAGGCAGGGCTGTGGTGG + Intergenic
1076007980 10:126963570-126963592 AAGGGAAGGGAGGGAAGGAGAGG - Intronic
1076046225 10:127296274-127296296 AAGGGAAGGCAGGGGAGGAGGGG + Intronic
1076054111 10:127357365-127357387 AAGGAAAGGCGGGCCCAGAAAGG + Intronic
1076704456 10:132293663-132293685 CAGGGCAGGCAGGGCCAGAGTGG + Intronic
1076859464 10:133133764-133133786 CAGGGCAGGCGGAGCAGGAGGGG + Intergenic
1077048161 11:555227-555249 AGGGGAGGGAGGGGCGGGAGAGG + Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1078338573 11:10483178-10483200 CAGGGAAGGGGAGGTCGGAGAGG + Intronic
1079512577 11:21228706-21228728 GAGGGAAGGAGGGGTGGGAGGGG - Intronic
1080194049 11:29587040-29587062 AAAGGCAGGTGGGGCAGGAGTGG + Intergenic
1081571562 11:44294506-44294528 ATGGGGAGGAGGGGCCTGAGGGG + Intronic
1082001182 11:47394520-47394542 AGAGGAAGGCGGGCCTGGAGCGG + Intergenic
1082759403 11:57112613-57112635 AGGGGAAGGGGAGGCAGGAGAGG - Intergenic
1083692693 11:64419834-64419856 AAGGGAAGGCAGAGCCAGCGGGG - Intergenic
1083881776 11:65552486-65552508 AAGGGTTGTCTGGGCCGGAGAGG - Intronic
1084000996 11:66295426-66295448 AAGGGCAGGCGGGGCCCGCTGGG - Exonic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1084640401 11:70422681-70422703 AGGGGCAGGAGGGGCAGGAGGGG - Intronic
1085076746 11:73598191-73598213 CAGGGAAGGAGGAGCCGGCGCGG + Intergenic
1085475268 11:76784941-76784963 AAGGGAAACTGAGGCCGGAGAGG - Intronic
1086336961 11:85810311-85810333 AAGGGAAGACGCGGCAGGATGGG + Intronic
1088731479 11:112687668-112687690 CAGGGCAGGAGGGGCGGGAGGGG + Intergenic
1089123188 11:116155524-116155546 AAGGGAAGGAGGGGAAGGAGAGG + Intergenic
1090404048 11:126466739-126466761 CAGGGAAGGGAGGGGCGGAGTGG - Intronic
1090409967 11:126501341-126501363 AGGGGAAGACGGGGCTGCAGAGG + Intronic
1090773495 11:129943567-129943589 AAGGGAAGATGGGCCAGGAGAGG + Intronic
1091453536 12:588179-588201 AAGGGACGGAAGGGACGGAGGGG + Intronic
1091453539 12:588188-588210 AAGGGACGGAGGGGACGGAAGGG + Intronic
1091453546 12:588206-588228 AAGGGACGGAGGGGACGGAAGGG + Intronic
1091721227 12:2815488-2815510 AAAGGATGGTGGGGCCTGAGGGG - Intronic
1092048794 12:5453356-5453378 TAGGGAAGGGGAGGCAGGAGGGG - Intronic
1092261038 12:6953462-6953484 AAGGGAGGGCAGTGCCGGGGCGG + Intronic
1092696639 12:11178377-11178399 AAGGGAAGGGGTGGGAGGAGAGG + Intergenic
1093990083 12:25580232-25580254 GATGGAAGGAGGGGCCAGAGGGG - Intronic
1095444640 12:42271759-42271781 AAGGGAGGGAGGGGAGGGAGGGG - Intronic
1096191587 12:49623494-49623516 CCGGGAGGGCGGGGCCGGCGGGG - Exonic
1097190553 12:57217414-57217436 ATGGGAAGGCGGGGGTGGAGGGG - Intronic
1097831785 12:64232618-64232640 AAGGGAAGCAGGGGCAGGATTGG - Intergenic
1099121891 12:78700679-78700701 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
1100550688 12:95644203-95644225 AGGGGAAGGAGGGGGAGGAGGGG - Intergenic
1100909540 12:99342616-99342638 AAGAAAAGGCGAGGCCAGAGTGG + Intronic
1101171482 12:102101162-102101184 AAGGGAAGGATGGGGGGGAGGGG - Intronic
1102278168 12:111598736-111598758 AGGGGACGCCGGGCCCGGAGCGG + Intronic
1102990408 12:117311597-117311619 AAGGCAAGGTGGGGCAGGTGAGG + Intronic
1103209038 12:119153710-119153732 ACGGGGAGGCGGGGCCAGAGAGG - Intronic
1103514780 12:121500428-121500450 AAGGGATGGCTGGGCCTGGGCGG + Intronic
1103553412 12:121751652-121751674 AAGGGAGGGAGGGGAGGGAGGGG - Intronic
1103863779 12:124034994-124035016 AAAGGCAGGAGGGGTCGGAGGGG + Intronic
1103924947 12:124418469-124418491 AAGGGAAGGCGGGGCAGCTCTGG + Intronic
1104066865 12:125313636-125313658 AAGGAAAGGTGGGGGAGGAGAGG - Intronic
1104625919 12:130354591-130354613 AAGAGAAGGCGGGGCCCTGGGGG + Exonic
1104784190 12:131439128-131439150 AAGGGAGGGCCGGGAGGGAGCGG - Intergenic
1104820108 12:131672184-131672206 AAGGGAAGGCTGGGCCCCAGTGG - Intergenic
1104921460 12:132292770-132292792 AAGGGAAGGAGGGTGGGGAGAGG + Intronic
1104988736 12:132612243-132612265 AAGGGGAGGCAGGGCGGGATGGG + Intergenic
1105541187 13:21319030-21319052 CTGGGGAGGCGGGGCGGGAGAGG + Intergenic
1105896139 13:24718642-24718664 ATGGGAAGGCAGGGCTGGTGCGG + Intergenic
1106269348 13:28138684-28138706 AAGGGGAGGCGGCGGCCGAGGGG - Exonic
1106703087 13:32250407-32250429 AAGGGAAGGTGGGGACAGTGAGG - Intronic
1107548893 13:41457484-41457506 GAGCGGAGGCGGGGCCGGGGCGG - Intergenic
1107810580 13:44196359-44196381 AAGGGAGGTCAGGGCTGGAGGGG - Intergenic
1108396584 13:49996788-49996810 AAGGCGAGGCGCGGCCGGGGAGG + Intronic
1108492368 13:50994221-50994243 AGGGGAAGGCGGAGGGGGAGGGG - Intergenic
1109370359 13:61414181-61414203 GGGGGAAGGCGGGGGCGGAGGGG - Intronic
1110935397 13:81281163-81281185 AAGGGAAGGAGGAGGAGGAGAGG + Intergenic
1111337880 13:86846424-86846446 AGGGGAAGGGGGGGCTGGTGTGG + Intergenic
1111951187 13:94711051-94711073 GAGGCCAGGCGGGGCAGGAGTGG - Exonic
1112460576 13:99600393-99600415 CAGGGAAGGGGGCTCCGGAGAGG + Intergenic
1112580863 13:100675109-100675131 AGGCGGAGGCGGGGCCGGGGCGG + Intergenic
1112692809 13:101916332-101916354 AAGGGAGGCCGGGGCCGGGGTGG + Intronic
1113061388 13:106325952-106325974 AAGGGAACGTGGGGTGGGAGAGG - Intergenic
1113292182 13:108919255-108919277 GAGGGAAGGTGGGGCAGGAAGGG - Intronic
1113673960 13:112195749-112195771 AAAGGAAGGCAGGGAAGGAGGGG - Intergenic
1113805892 13:113109930-113109952 ATGGGAAGACGGGGCTGGTGAGG - Intronic
1113808309 13:113122664-113122686 TGGGGAAGGTGGGGCCAGAGTGG + Intergenic
1113940392 13:114015824-114015846 AAGGGAAGGAGGAGCCGGGGCGG + Intronic
1114633239 14:24172795-24172817 AAGGGAAGGAGGGCCTGGTGCGG + Intronic
1116075059 14:40100825-40100847 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116075067 14:40100845-40100867 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1117343699 14:54812860-54812882 ATGGGGAGCCGGGGCTGGAGAGG + Intergenic
1118697017 14:68395159-68395181 AAGGGGAGGCGGGAGAGGAGGGG - Intronic
1118992353 14:70808740-70808762 AGGCGAAGGCGGGGCCGGGCGGG - Intronic
1119341522 14:73883144-73883166 CAGGGAAGGGGAGGCCAGAGAGG - Intronic
1119602474 14:75985897-75985919 CAGAGAAGTCGGGGCCGGCGGGG - Intronic
1121018915 14:90567029-90567051 AGGGGAAGGCGGGGGCGGGGAGG + Intronic
1121524917 14:94613159-94613181 AGGGGAAGGAGGGGAAGGAGGGG - Intronic
1121524921 14:94613168-94613190 AGGGGAAGGAGGGGAAGGAGGGG - Intronic
1121524925 14:94613177-94613199 AAGGGAAGGAGGGGAAGGAGGGG - Intronic
1122220784 14:100238398-100238420 AAGGGAGGGAGGGGCCGGCCGGG - Intronic
1122486864 14:102087459-102087481 AGCGGAACGCGGGGCCGGGGTGG + Intronic
1122768210 14:104085645-104085667 CTGGGAGGGCGGGGCCGGCGGGG - Intergenic
1122941486 14:104983328-104983350 TAGGGGAGACTGGGCCGGAGAGG - Intergenic
1122941999 14:104985669-104985691 CAGGGAGGGCGGGTCCGGGGCGG + Intergenic
1122961212 14:105094275-105094297 TAGGGAAGGCTGGGCCCGGGGGG + Intergenic
1123036471 14:105473953-105473975 AAGGGAAGGAGGGGAAGGAGTGG - Intronic
1202904391 14_GL000194v1_random:59983-60005 CAGGGAAGAGGAGGCCGGAGGGG - Intergenic
1123434917 15:20247835-20247857 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
1123710132 15:22980595-22980617 GCGGGACGGCGGGGTCGGAGCGG + Intronic
1124181790 15:27482905-27482927 AAAGCATGGCGGGGCCAGAGTGG - Intronic
1124190790 15:27574618-27574640 AGGGGAAGGAGGGGCAGGAGGGG - Intergenic
1124612236 15:31216220-31216242 AGGGGAAGGGGGAGGCGGAGGGG + Intergenic
1125675843 15:41502265-41502287 AGGGGCAGGCGGGGCGGGAGCGG - Intronic
1125733589 15:41908374-41908396 AAGGGAAGGTCGGGCAGAAGAGG - Intronic
1125769409 15:42154877-42154899 GAGGGCAGGCAGGGCTGGAGGGG - Intronic
1127470093 15:59282860-59282882 AAGGGAAGGGGGAGTGGGAGAGG + Intronic
1127582386 15:60349958-60349980 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582401 15:60349994-60350016 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582416 15:60350030-60350052 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582431 15:60350066-60350088 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582439 15:60350084-60350106 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582447 15:60350102-60350124 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127582455 15:60350120-60350142 AGGGGAAGGCAGGGAGGGAGGGG + Intronic
1127646583 15:60964812-60964834 AAGGGAAGTGGTGGCTGGAGTGG + Intronic
1127759095 15:62120549-62120571 GAGGGAATGAGGGGCCAGAGAGG - Intergenic
1128327429 15:66734089-66734111 GAGGGAGGGAGAGGCCGGAGAGG + Intronic
1128452477 15:67813708-67813730 AGGGGAAGGCAGGGTGGGAGGGG + Intergenic
1128506791 15:68278242-68278264 CAGGGAAGGCGGAGACGCAGAGG - Exonic
1128576289 15:68777519-68777541 AAGGGAAGTCGAGGCTGCAGTGG - Intergenic
1129144233 15:73633066-73633088 GAGGGGCGCCGGGGCCGGAGGGG - Intronic
1129189277 15:73927904-73927926 AGGGGTACGCGCGGCCGGAGGGG - Intronic
1129238890 15:74240220-74240242 AAGGGAAGGCTGTCCCCGAGGGG + Intronic
1129710930 15:77819904-77819926 AAGGCAGGGAGGCGCCGGAGAGG - Intronic
1129878095 15:78990057-78990079 AAGGGGTGGCAGGGCTGGAGAGG + Intronic
1130766451 15:86876241-86876263 AAGGGAAGGCGGGGGTTGAATGG + Intronic
1130831974 15:87610169-87610191 AAGGGAAGCCCGGGCCTGACAGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131311693 15:91296401-91296423 AAGGAAAGCCAGGGCTGGAGTGG + Exonic
1132150031 15:99452725-99452747 AGGTGGAGGCGGGGCAGGAGCGG - Intergenic
1132349824 15:101132863-101132885 AAGGGAAAAGGGGGCCAGAGAGG - Intergenic
1132674745 16:1117018-1117040 AAAGGAAGGTGGGGGCGGGGAGG - Intergenic
1132683329 16:1152698-1152720 AGGGGGAGGGGGAGCCGGAGCGG + Intergenic
1132843689 16:1990402-1990424 AGGGGCCGGCGGCGCCGGAGAGG + Intronic
1132897316 16:2235152-2235174 TAGGGCAGGCGGGGGCGGGGAGG + Intronic
1132929125 16:2449760-2449782 AGGGGATGGAGGGGACGGAGGGG - Intronic
1132929133 16:2449778-2449800 AGGGGATGGAGGGGACGGAGGGG - Intronic
1133616546 16:7482439-7482461 AATGGAAGGAGGGGCTGAAGAGG - Intronic
1134314727 16:13108123-13108145 AAAGCAGGGTGGGGCCGGAGGGG - Intronic
1134459465 16:14419036-14419058 TAGGGAAGGCTGGGCCGAAAGGG + Intergenic
1135280571 16:21150871-21150893 AAGGGAAGGAGGGGCCTCTGCGG + Intronic
1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG + Intergenic
1136491219 16:30609780-30609802 AAGGGATGCAGGAGCCGGAGAGG - Intronic
1136547864 16:30965662-30965684 AGGGGGCGTCGGGGCCGGAGGGG - Exonic
1136849703 16:33603153-33603175 AAGGGAAGGGAGGGGAGGAGAGG - Intergenic
1138187398 16:54987096-54987118 GAGGGAAGGGGGGGCCGCCGTGG + Intergenic
1138552825 16:57756692-57756714 AAGGGAAGGCGGAGGCCCAGAGG - Intronic
1139475322 16:67200008-67200030 TGGGGAAGGCGGGACGGGAGGGG - Intronic
1140481631 16:75265628-75265650 ATGGAAAGGCGGGGGCAGAGAGG + Intronic
1140487431 16:75304805-75304827 GAGGGAAGGCGGGGCATGTGAGG - Intronic
1140905881 16:79408680-79408702 AAGGGATGGAGGGGAGGGAGGGG - Intergenic
1141623149 16:85247756-85247778 GAGGGAACGCGGGGAGGGAGGGG + Intergenic
1142039127 16:87881358-87881380 AGGAGAGGGCGGGGGCGGAGGGG + Intergenic
1142232326 16:88905695-88905717 AAGGAGGGGCGGGGCTGGAGGGG + Intronic
1142717758 17:1756197-1756219 AGGGGACGGTGGGGCTGGAGTGG + Intergenic
1142756664 17:2020474-2020496 AAGGGAAGGAGGGACCGTGGTGG - Intronic
1143030282 17:3963887-3963909 CAGGGTGGACGGGGCCGGAGTGG + Intronic
1143297645 17:5883410-5883432 AAGGGAAGGCAGGGGAGGGGAGG - Intronic
1143297676 17:5883482-5883504 AAGGGAAGGCGGGGAGGGGACGG - Intronic
1143394245 17:6579601-6579623 AAAGGAAGGCAGTGCCGGGGAGG - Exonic
1143479026 17:7218185-7218207 AGGGGCAGGCAGGGCTGGAGGGG - Intronic
1143487456 17:7262549-7262571 AGGGGGAGGCGGGACCGGAGGGG + Intronic
1143490844 17:7284456-7284478 AAGGGAAGGTCAGGCCTGAGGGG - Intronic
1143755506 17:9064386-9064408 AAGAGAAGTCAGGGCCAGAGAGG - Intronic
1143765969 17:9138022-9138044 CAGGGAAGGCTGGGCTGGGGAGG - Intronic
1144519426 17:15944491-15944513 AAGGCAGAGCGGGGCCGTAGGGG + Intergenic
1144764170 17:17723900-17723922 AAGGAAACGCGGGGCGCGAGAGG + Intronic
1144800314 17:17921736-17921758 AAGGGAAAGTGGGGGCGGGGTGG + Intronic
1144878016 17:18412363-18412385 AGGGGGAGGAGGGGACGGAGAGG + Intergenic
1145154214 17:20532062-20532084 AGGGGGAGGAGGGGACGGAGAGG - Intergenic
1145909702 17:28535216-28535238 AAGGGAAGGTGGGACAGGACTGG + Intronic
1146182944 17:30709088-30709110 GAGGGGCGGCGCGGCCGGAGGGG - Intergenic
1146453703 17:32993810-32993832 AGGGGAAGGAGGAGCAGGAGGGG + Intronic
1146514669 17:33479957-33479979 ATGGGAAGGAGGGGCCTCAGGGG - Intronic
1146896352 17:36544875-36544897 AGGGGAAGGTGGGGCCGGGCGGG - Exonic
1147042952 17:37731949-37731971 AATGGAAGGCTGGGGAGGAGAGG + Intronic
1147137301 17:38441735-38441757 AAGGGAAGAAGGGGACGGGGAGG + Intronic
1147149970 17:38509031-38509053 AGGGGAAGGCAGGGGCGGGGCGG + Intronic
1147364868 17:39953017-39953039 GAGTGAAGGCGGGGCTGGGGTGG + Intergenic
1147420787 17:40321319-40321341 AGGGGAGGGCGGGACTGGAGCGG - Intronic
1147743067 17:42679599-42679621 GAAGAAAGGCGGGGCCGGCGGGG + Exonic
1147833751 17:43315411-43315433 AAGCGAAGGCGGAGCCGACGAGG - Intergenic
1147891582 17:43720953-43720975 AGGGGACGGAGGGGGCGGAGGGG + Intergenic
1147978044 17:44259143-44259165 AGGGTAAGGAAGGGCCGGAGAGG - Exonic
1148116219 17:45176783-45176805 AAGGGAGGGAGGGCCGGGAGCGG - Intergenic
1148166950 17:45490468-45490490 GGGGGAAGGCTGGGTCGGAGAGG + Intronic
1148473023 17:47907236-47907258 AAGAGAAGGCTGTGCTGGAGGGG + Intronic
1148764205 17:50027953-50027975 ATGGGAGGGCGGGGCAGGCGTGG + Intergenic
1149567649 17:57651434-57651456 AAGGGAGTGCGGGGCTGCAGGGG - Intronic
1150142778 17:62744147-62744169 AGGGGAAGGCGGGGTCGGGGGGG - Intronic
1150249894 17:63699644-63699666 AGGGGAGGTCGGGGCCGGCGGGG + Intronic
1150373662 17:64662367-64662389 GACGGGAGGCGGGGCCGGCGGGG + Intergenic
1150398129 17:64836872-64836894 GGGGGAAGGCTGGGTCGGAGCGG + Intergenic
1150778620 17:68101527-68101549 GATGGGAGGCGGGGCCGGTGGGG - Intergenic
1151623371 17:75261352-75261374 GAGGGAAGCGGGGGCCGGACTGG + Intronic
1151768999 17:76147425-76147447 CATGGAATGCTGGGCCGGAGAGG + Intronic
1151947394 17:77327187-77327209 GAGGGGTGGTGGGGCCGGAGGGG - Intronic
1152071759 17:78137656-78137678 AAGGGAAGGAAGGGCCGGGGTGG + Intronic
1152228267 17:79102573-79102595 CAGGGAAGGAGGGGACAGAGCGG + Intronic
1152303733 17:79509586-79509608 AAGGGAAGGAGGGGTTGGGGTGG - Intronic
1152606783 17:81295373-81295395 AATGAGAGGCGGGCCCGGAGGGG + Intronic
1152609186 17:81307368-81307390 AAGGGAAGGAGGAGGGGGAGGGG - Intergenic
1152623988 17:81380018-81380040 GAGGGGAGGCGGGGGGGGAGCGG - Intergenic
1152748570 17:82052173-82052195 GAGGGGAGGCGGGGCGGGCGCGG - Exonic
1203165548 17_GL000205v2_random:89744-89766 AAGGAAAAGTGGGGCGGGAGGGG - Intergenic
1153457458 18:5296041-5296063 ACGGGAAGGGGGGGGCGGTGGGG - Intronic
1156138190 18:34070307-34070329 AAGGCAAGGCGGGCCGGGCGCGG - Intronic
1156149000 18:34222336-34222358 AAGGGAATGGGGGGGCGGGGAGG + Intronic
1158514366 18:58119167-58119189 AAGGGAAGGTGGGGCATGAGGGG - Intronic
1159920247 18:74221276-74221298 GAGAGAAGGAGGGGCCCGAGTGG + Intergenic
1160594508 18:79964580-79964602 GGGCGGAGGCGGGGCCGGAGCGG - Exonic
1160763727 19:798008-798030 AAGCGCAGGCGGGGCTGGGGCGG + Intronic
1160869230 19:1269471-1269493 CAGGCGAGGCGGGGCCGCAGCGG + Intronic
1160984919 19:1834022-1834044 GAGGGCAGGCGGGGGTGGAGGGG + Intronic
1161424910 19:4198212-4198234 AAGGTCAGGAGGGGCCGGGGCGG + Intronic
1161485838 19:4535227-4535249 AAGGGCGGGCGGGACCGGCGGGG - Intronic
1161582921 19:5090640-5090662 GGGGGAAGGGGGGGCCGGAGGGG - Intronic
1161703125 19:5805459-5805481 AGGGGCAGGCGGGGCAGGTGGGG + Intergenic
1161779279 19:6280130-6280152 ATGGGAGGCCGGGACCGGAGGGG + Intergenic
1162226287 19:9225401-9225423 AAGGGAAGGAGGGGAAGGAAGGG + Intergenic
1162501924 19:11058943-11058965 AAGGGAAGGAGGGGCGGGTTGGG - Intronic
1162914219 19:13865576-13865598 AATGGAGGGCCGGGCCGCAGAGG - Intronic
1162992851 19:14314602-14314624 AAGGGGAGGCTGGGTGGGAGGGG + Intergenic
1163029871 19:14537156-14537178 AAGAAGAGGCGGGGCCGGGGGGG + Intronic
1163271002 19:16253890-16253912 CAGGGCAGGCGGGGCGGGGGAGG - Intergenic
1163398278 19:17076488-17076510 TAGGGAGGGAGGGCCCGGAGAGG + Intronic
1163399990 19:17086304-17086326 ATGGGCAGGCGGGGCCAGAGTGG - Intronic
1163779774 19:19240128-19240150 AAAGGGAGGAGGGGCAGGAGTGG - Intronic
1164753304 19:30671551-30671573 AAGGGGAAGCGGGGCAGGGGTGG + Intronic
1165069702 19:33248300-33248322 AAGGGAAGGCGGGCCAGGAAAGG - Intergenic
1165144892 19:33724686-33724708 AAGGGAAGGCAGGGAAGGAGAGG - Intronic
1165448222 19:35868478-35868500 CCAGGAAGGCGGGGCCGGCGCGG + Exonic
1165743476 19:38217172-38217194 AAGGGAAGGCAGGGCGGGAGGGG + Intronic
1165793492 19:38505945-38505967 AGGTGAAGGCGGGGCCTGGGTGG + Exonic
1166161781 19:40959456-40959478 GAGGGAAGGAGGGGAAGGAGAGG - Intergenic
1166198201 19:41220109-41220131 AAGAAAAGGTGGGGGCGGAGGGG - Intronic
1166304858 19:41931896-41931918 AAGGGAAGGTGGGGGTGGTGTGG + Intergenic
1166373105 19:42313349-42313371 GAGCGGAGCCGGGGCCGGAGCGG + Exonic
1166524821 19:43504380-43504402 GAGGGGAGGCGGGGTCGAAGAGG - Intronic
1166567911 19:43776338-43776360 AGGGGAAGGCGGAGCTGGTGGGG + Intronic
1166580672 19:43895832-43895854 AAGGGAAGGGAGGGAGGGAGAGG + Intronic
1166831248 19:45641086-45641108 AAGGTTGGGCGGGGCCGTAGGGG - Intronic
1167019162 19:46861272-46861294 AGGGGGAGGCGGGGACGGCGGGG + Intergenic
1167091738 19:47349084-47349106 AGGAGAGGGCGGGGCCGGGGAGG + Intergenic
1167145112 19:47676604-47676626 GAGGGAAGGCGGGGAGGGTGAGG - Intronic
1167284559 19:48591744-48591766 AGGGTAAAGCGGGGCAGGAGGGG + Intronic
1167494297 19:49808855-49808877 ATGGGAAGGCGGGGCCGGCGGGG + Intronic
1167611318 19:50509013-50509035 ATGGGCAGGCTGGGCAGGAGAGG + Intronic
1167651136 19:50729657-50729679 AAGGGAGGGAGGGGAGGGAGGGG + Intergenic
1167709677 19:51102726-51102748 AAGGGCAGGGGAGGCTGGAGAGG - Intronic
1167971998 19:53193435-53193457 TAGGGTGGGCGGGGCCGGGGCGG + Intergenic
1168353233 19:55688058-55688080 TTGGGAGGGCGGGGCAGGAGAGG + Intronic
1168357946 19:55713825-55713847 GATGGAAGTCGGGGCAGGAGCGG - Intronic
1168483464 19:56740929-56740951 AAGGGAAGGCAGGGGAGGAGAGG - Intergenic
1168483484 19:56740979-56741001 AAGGGAAGGCAGGGGAGGAGAGG - Intergenic
1168483503 19:56741029-56741051 AAGGGAAGGCAGGGGAGGAGAGG - Intergenic
924988154 2:289009-289031 GGGGGAAGGTGGGGCAGGAGAGG - Intergenic
925121176 2:1419618-1419640 AAGGGAGGCCGGGGCTGCAGAGG - Intronic
925781493 2:7386243-7386265 AAGGGAAGGAGGTGTGGGAGTGG + Intergenic
925917463 2:8617002-8617024 AAAGGTTGGCGGGCCCGGAGGGG + Intergenic
925943014 2:8837696-8837718 TAGAGCAGGCGGGGCTGGAGGGG + Intergenic
926089892 2:10043227-10043249 AGGGGGCGGCGGGGGCGGAGGGG - Intronic
926089902 2:10043245-10043267 AGGGGGCGGCGGGGGCGGAGGGG - Intronic
927052917 2:19348071-19348093 AGAGGAGGGCGGGGCCGCAGTGG + Intergenic
927107707 2:19842056-19842078 AAGGGAAGGAGGGAGGGGAGGGG + Intergenic
928421205 2:31138689-31138711 AAGGCGGGGCGGGGCGGGAGCGG + Intronic
931681284 2:64751456-64751478 AGGGGAGGGCTGGCCCGGAGAGG - Intergenic
932756748 2:74414849-74414871 AAAGGAATGCCTGGCCGGAGAGG + Exonic
934555865 2:95286745-95286767 AAGGGAAGGGGAGGGAGGAGAGG - Intronic
935870570 2:107444075-107444097 AAAGGCAGGCTGGGCCAGAGAGG - Intergenic
936104496 2:109613666-109613688 CTGGGCGGGCGGGGCCGGAGGGG + Intronic
936234605 2:110732474-110732496 AGGGCAGGGCGGGGCCGGGGAGG + Intergenic
936388706 2:112054298-112054320 GTGGGGAGGCGGGGCCTGAGTGG - Intergenic
936537739 2:113324982-113325004 AGGGGAGGGCGGGGCCGAGGGGG - Intergenic
936551039 2:113439850-113439872 AAGGGAAGGGGGGAATGGAGGGG - Intronic
938416272 2:131105734-131105756 GAGGGTCCGCGGGGCCGGAGAGG - Intronic
938725404 2:134104352-134104374 AAGGAAAGGGGTGGCTGGAGAGG + Intergenic
940903410 2:159147278-159147300 AAGGGAAGGGGGGTGTGGAGTGG + Intronic
941368801 2:164638623-164638645 CAGAGAAGGCGGGGTTGGAGAGG + Intergenic
942428431 2:175883872-175883894 AATGGAAGGCTGGGCTGGGGAGG + Intergenic
942482327 2:176402902-176402924 AAGGGAAGGGAGGGAGGGAGAGG - Intergenic
943840543 2:192574597-192574619 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
946433985 2:219640229-219640251 AAGAGAAGGAGGGGCGGGGGGGG - Intronic
947834639 2:233166592-233166614 AGGGGAAGGAGGGGAAGGAGGGG - Intronic
948836171 2:240627003-240627025 AAGGGGAAGCGGGGCCTCAGAGG + Intronic
948917345 2:241041176-241041198 AGGGGAGGGTGGGGCAGGAGCGG + Intronic
949051933 2:241902325-241902347 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051940 2:241902342-241902364 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051947 2:241902359-241902381 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051954 2:241902376-241902398 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051961 2:241902393-241902415 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051968 2:241902410-241902432 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
1168830888 20:844834-844856 AAGGTAGGGCGGGGGCGGACGGG - Exonic
1169262451 20:4148771-4148793 AGCGGAGGGCCGGGCCGGAGCGG + Exonic
1169270378 20:4194809-4194831 AAGGGAAGGAGAGGGTGGAGAGG - Intergenic
1169765600 20:9144720-9144742 AGGGGAAGGAGGGGAAGGAGGGG + Intronic
1169765604 20:9144729-9144751 AGGGGAAGGAGGGGAAGGAGGGG + Intronic
1169765608 20:9144738-9144760 AGGGGAAGGAGGGGAAGGAGGGG + Intronic
1169765612 20:9144747-9144769 AGGGGAAGGAGGGGAAGGAGGGG + Intronic
1170367931 20:15617814-15617836 TAGGGAAGGTGGGGGTGGAGAGG + Intronic
1170699997 20:18695416-18695438 AGGGGAAGGGGGAGGCGGAGGGG - Intronic
1170700066 20:18695594-18695616 AAGGGAAGGGGGGAGGGGAGGGG - Intronic
1171158084 20:22895180-22895202 AAGGGATGGGAGGGCCAGAGAGG + Intergenic
1171191548 20:23162836-23162858 AAGGGAAGGAGGGGCCTGGTGGG - Intergenic
1171385781 20:24768621-24768643 AAGGGAAGGCGGAGGCAGATAGG - Intergenic
1172163917 20:32887138-32887160 TAGGGAAGGCAGGGGCAGAGAGG - Intronic
1174216611 20:48921208-48921230 ATGAGAAGGCGGCGGCGGAGGGG - Intergenic
1174253424 20:49236278-49236300 AAGGGAAGGGGGGTGCGAAGAGG - Intronic
1174280856 20:49438167-49438189 AGGGGAAGGAGGGGAGGGAGAGG - Intronic
1174442696 20:50568696-50568718 AGGAGAAGGCGGGGGCGAAGAGG - Intronic
1175278822 20:57788955-57788977 GAGGGCAGGAGGGGCCCGAGAGG + Intergenic
1175579320 20:60086885-60086907 AATGGAAGGTGAGGCGGGAGAGG + Intergenic
1175989249 20:62779313-62779335 AAGGGAAGGTGGGGGCTGTGGGG - Intergenic
1176053821 20:63134506-63134528 CAGGGGAGGCAGGGCCTGAGGGG + Intergenic
1176053838 20:63134542-63134564 ATGGGGAGGCGGGGCCCCAGGGG + Intergenic
1176053846 20:63134559-63134581 CAGGGGAGGCGGGGCCTTAGAGG + Intergenic
1176054023 20:63134966-63134988 GAGAGAAGGCGGGGCCACAGGGG + Intergenic
1176054040 20:63135001-63135023 GAGGGGAGGCGGGGCCACAGGGG + Intergenic
1176054071 20:63135071-63135093 CAGGGGAGGCAGGGCCTGAGGGG + Intergenic
1176054088 20:63135107-63135129 ATGGGGAGGCGGGGCCCCAGGGG + Intergenic
1176054166 20:63135301-63135323 GAGGGGAGGCGGGGCCACAGGGG + Intergenic
1176054246 20:63135478-63135500 GAGAGAAGGCGGGGCCACAGGGG + Intergenic
1176126630 20:63478462-63478484 AAGGGAGGACGGGGGCAGAGGGG - Intergenic
1176129509 20:63490757-63490779 AGGGGAAGGTGGGGCCCGAGGGG + Intronic
1176406204 21:6369335-6369357 AAGGAAAAGTGGGGCGGGAGGGG + Intergenic
1176623759 21:9074750-9074772 CAGGGAAGAGGAGGCCGGAGGGG - Intergenic
1179160021 21:38887520-38887542 CAGGGAAGACGGGGCCGTATTGG - Intergenic
1180109533 21:45641739-45641761 AAGGGAAGGTGGGCCGGGCGCGG - Intergenic
1181265556 22:21628855-21628877 AAGGGACGGCGGGGTGGGAGGGG + Intronic
1181466735 22:23114447-23114469 AAGGGAAGGCATTGCAGGAGGGG - Intronic
1181468930 22:23126334-23126356 AGGGGAGGACGGGGCCAGAGAGG - Intronic
1181484292 22:23220725-23220747 ATGGGAATGCGGGTCCAGAGAGG - Intronic
1181534188 22:23533260-23533282 AAAGGAAGGCAGGGAAGGAGAGG + Intergenic
1182289308 22:29266247-29266269 AAGGGGAGCCAGGGCCAGAGGGG - Intronic
1182355219 22:29719848-29719870 AAGGGGAATCGGGGCCGAAGGGG + Intergenic
1182446450 22:30392564-30392586 AGGGGAGGGGAGGGCCGGAGGGG - Intronic
1183306110 22:37084089-37084111 AGGGGAAGCCGGGGCCAGGGCGG + Intronic
1184051403 22:42008201-42008223 AAGGGAAGGGAGGGGAGGAGAGG - Intronic
1184100762 22:42340832-42340854 AAGGGAAGGGGGAGGGGGAGGGG + Intronic
1184233602 22:43171447-43171469 CAGGGCAGGCGGGGGCGGGGAGG - Intronic
1184532780 22:45067003-45067025 AAGGGAAGGAGGGTGTGGAGAGG + Intergenic
1184697904 22:46150232-46150254 AAGGGAAACTGAGGCCGGAGAGG - Intergenic
1185281311 22:49971263-49971285 AGGGGAACGCGAGGCCGGGGTGG + Intergenic
949540208 3:5026678-5026700 CAGGGAAGGCCGGGCGGGGGTGG - Intergenic
950035223 3:9880254-9880276 AAGGGAGGGCTGGGCGGGACAGG - Exonic
950526638 3:13528322-13528344 GAGGCAAGGCAGGGCCGGGGAGG + Intergenic
950537455 3:13587620-13587642 AAGGGAAGTGGGGGTCAGAGAGG + Intronic
950640687 3:14346315-14346337 GAGGGAAGGGAGGGCCCGAGGGG - Intergenic
953909168 3:46883174-46883196 AAGAAAAGGCGGCGCGGGAGGGG + Intronic
954253088 3:49383563-49383585 AGGGGAAGGTGGGGCTGGAGAGG - Intronic
954613062 3:51956337-51956359 CCGGGCAGGCGAGGCCGGAGCGG - Exonic
954656158 3:52195436-52195458 AAGAGGAGGAGGGGGCGGAGGGG + Intergenic
955887985 3:63620631-63620653 AAGGGAAGGCTGGCCGGGCGCGG - Intergenic
956604894 3:71064623-71064645 AAGTGGAGGCGGGGAGGGAGTGG - Intronic
959398281 3:105868708-105868730 AAGGGAAGGGGTCGCCGGGGAGG - Intronic
961058664 3:123810304-123810326 AAGGGAAGCAGGGGCAGGGGAGG - Intronic
961149872 3:124628455-124628477 AAGGGAAGGAAGGGAAGGAGGGG - Intronic
961530914 3:127539877-127539899 AAGAGAAGGCAGGGCTGGCGGGG + Intergenic
961629467 3:128285467-128285489 AAGAGATGGCTGGGCCTGAGAGG + Intronic
962793919 3:138834770-138834792 CAGGGATGGGGGCGCCGGAGTGG - Intronic
962941523 3:140128826-140128848 AAGGGAAGGTGGATCTGGAGAGG + Intronic
964133654 3:153318908-153318930 AAGGGAAGGAAGGGGAGGAGAGG + Intergenic
964696743 3:159516552-159516574 AATGGAAGGAGGGGTTGGAGAGG - Intronic
965594859 3:170400567-170400589 AAGGGAAGGAGGAGAGGGAGGGG - Intergenic
966177048 3:177149707-177149729 AATGGTTGGGGGGGCCGGAGGGG + Intronic
968088477 3:195885355-195885377 AAGGGAGGGTGGGGCAGGACTGG - Intronic
968206911 3:196811250-196811272 AAGGGAAGGAAGGGAGGGAGGGG - Intronic
968642445 4:1721386-1721408 GAGGGAGGGCGGAGCCGGCGAGG + Intergenic
968652979 4:1767369-1767391 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652988 4:1767387-1767409 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652997 4:1767405-1767427 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
969138744 4:5051474-5051496 AGGGGAAGGAGGGGAAGGAGCGG - Exonic
969621034 4:8278999-8279021 AAGGGATGGAGGGGGAGGAGGGG - Intronic
969624529 4:8295556-8295578 AAGAGAAGGTGGGGAGGGAGAGG - Intronic
969791609 4:9497234-9497256 AAGGGAGGGAGGGGGCGCAGTGG + Intergenic
970597637 4:17614701-17614723 AAGGCCCGGCGGGGCCTGAGGGG - Exonic
971570923 4:28209964-28209986 AAGGGGAGGAGGGGGAGGAGGGG - Intergenic
971727742 4:30335609-30335631 AAGGGAAGGGGGGAGTGGAGGGG + Intergenic
973642589 4:52917970-52917992 GAGGGAAGGTGGGGCCAGTGGGG + Intronic
974385607 4:61200336-61200358 AGGCGCAGCCGGGGCCGGAGCGG - Intergenic
976426824 4:84913825-84913847 AAGGGAAGGGGAGGCCAGGGAGG - Intronic
976744831 4:88392130-88392152 AAGGGAAGACAGGGGAGGAGAGG - Intronic
976999588 4:91481071-91481093 AAGGGAAGGCAGGGGTGGGGAGG - Intronic
978503528 4:109433797-109433819 AAGGGAAGGCGGGGCCGGAGAGG - Exonic
978564933 4:110071621-110071643 GAGGGAAGGCTGGGCGGGAGAGG - Intronic
979231527 4:118352983-118353005 AAGAGAAGGCGCGGACGCAGCGG + Exonic
980807137 4:137828301-137828323 AAGGGAAGGAAGGGACAGAGAGG + Intergenic
981990048 4:150907316-150907338 AAGGGAGGGAGGGGGCAGAGAGG + Intronic
984612409 4:181856174-181856196 AAGGGAAGGAAGGGAGGGAGGGG + Intergenic
984928377 4:184826082-184826104 GCGGGAGGGCGGGGCCGGCGCGG - Intronic
985068384 4:186144813-186144835 GAGGGGAGGCGGCGCCGGCGCGG + Intronic
985660854 5:1155905-1155927 CGGGGAGGGCGGGGCCGGCGGGG + Intergenic
985746458 5:1651536-1651558 AGGGGAGGGCGGGGCTGGGGAGG + Intergenic
985926142 5:3020620-3020642 AAGGGAAGGTGGCGCCGGCCGGG + Intergenic
986013303 5:3736620-3736642 TAGGAAAGGCGAGGCCAGAGAGG + Intergenic
986142422 5:5043439-5043461 AAGGGAAGGAGGGAAGGGAGGGG + Intergenic
986466935 5:8035032-8035054 CAGAGAGGGCGGGGCCAGAGAGG + Intergenic
986721278 5:10563339-10563361 AGGGCAAGGCCGGGCCAGAGGGG + Intergenic
987264167 5:16235177-16235199 AAGGGGAGATGGGGCTGGAGGGG - Intergenic
988358880 5:30210499-30210521 AAGGGAAGGGAGGGGAGGAGGGG - Intergenic
988837627 5:35048597-35048619 AAGGTAAGGGGAGGCTGGAGTGG - Intergenic
990042777 5:51392758-51392780 AAGGGAAGCTGAGGCAGGAGTGG + Intronic
993386374 5:87267844-87267866 AAAGGAAGGCGGGGCAGGGGAGG - Intergenic
995064512 5:107844717-107844739 GAGGGAAAGCAGGGCCAGAGTGG + Intergenic
995908020 5:117149801-117149823 GAGGGAAGGCTGGGCAGGGGAGG - Intergenic
997194558 5:131969843-131969865 AAGGGAAAGCAGGGCTGTAGTGG + Intronic
997379418 5:133424654-133424676 AAGGGAAGGCTGGTCTGGACAGG + Intronic
997679909 5:135742970-135742992 AAGGGAGGGGGGGGAGGGAGGGG - Intergenic
998142137 5:139705956-139705978 AAGGGATGGAGGGGAGGGAGGGG + Intergenic
998374569 5:141682235-141682257 GAGGGGAGGCGGGGCCGGCGCGG - Intergenic
998760394 5:145425898-145425920 AAGGGAAGGCTGTGTGGGAGTGG - Intergenic
999352777 5:150892325-150892347 AAGGGAAAGGGAGGCAGGAGAGG + Intronic
999872320 5:155765383-155765405 AAGAGAAGGAGGGGAAGGAGGGG + Intergenic
1000282330 5:159792984-159793006 ACAAGAAGGCGGGGCCGGGGCGG + Intergenic
1001239073 5:170054357-170054379 AAGGGAAGAGGGGTCAGGAGTGG + Intronic
1001638433 5:173229113-173229135 AAGGGACGGCGGAGCCAGTGCGG + Intergenic
1001932169 5:175680935-175680957 AAGGGAAGGAGGGGCGGGAGAGG + Intronic
1002189902 5:177472935-177472957 AAGCGAGGGCGGGGGAGGAGCGG - Exonic
1002195513 5:177498800-177498822 ATGGGAAGGAGGGGCCAGTGGGG - Intergenic
1002430661 5:179202180-179202202 AGGGGAAGTCGGGGCCGGCAAGG - Intronic
1002787840 6:417876-417898 AAGGGAAGGAGAGGGAGGAGAGG + Intergenic
1003523999 6:6883292-6883314 AAAGGAGGGCGGGGGCTGAGTGG + Intergenic
1004544652 6:16586206-16586228 CAGGGAAGGAGGGGCAGGAACGG - Intronic
1006103743 6:31703321-31703343 CAGGGAGGGCGGGGCCGGCAGGG - Exonic
1006671448 6:35731982-35732004 AAGTGAGAGCGGGGGCGGAGCGG + Intergenic
1007154147 6:39725511-39725533 AGGGGAGGGCGGGGGTGGAGAGG + Intergenic
1007692107 6:43709128-43709150 AGGGGAAGGAGGGGGAGGAGGGG - Intergenic
1007939993 6:45771635-45771657 AGGGGAAGGCGGGGAAGTAGGGG - Intergenic
1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG + Intronic
1010243682 6:73642279-73642301 AGGGGGAGGCAGGGCCGGGGGGG - Intronic
1011412454 6:87080078-87080100 GAGGGAAGGAGGGTCAGGAGAGG - Intergenic
1012111581 6:95242056-95242078 AAGGGAAGGGAGGGCAGGGGAGG + Intergenic
1013292042 6:108728175-108728197 GAGGGAAGGCAGGGCCTCAGGGG + Intergenic
1014605194 6:123464910-123464932 AAGGGCAGGTGATGCCGGAGTGG + Intronic
1016714091 6:147204053-147204075 GAGGGACTGCGGGGCCGGGGCGG + Intergenic
1017006132 6:150029132-150029154 AAGGGCAGGTGAGGCTGGAGAGG - Intergenic
1017245663 6:152222033-152222055 AAGGGAGGGAGGGGTAGGAGTGG - Intronic
1017473672 6:154766253-154766275 GAGGGAAGGGGAGGCAGGAGAGG + Intronic
1017515467 6:155152360-155152382 AGGGGCAGGCAGGGCCTGAGAGG - Intronic
1017737798 6:157380534-157380556 GAGGGAGGCCGGGGCCGGAGGGG + Intergenic
1018686849 6:166309810-166309832 AAGAGAAGGTGAGGCAGGAGAGG + Intergenic
1018786728 6:167114174-167114196 AAGGGAAGGTGAGGAGGGAGAGG - Intergenic
1018897681 6:168032164-168032186 ACGGGAAGTGGGGGCCGGACAGG - Intronic
1018898129 6:168035410-168035432 AAGGGATGCCGGGGCTGGAACGG + Intronic
1018915274 6:168129092-168129114 AGGCCTAGGCGGGGCCGGAGAGG - Intergenic
1019058398 6:169238985-169239007 AAGGGAACTCGGGGCAGGGGTGG + Intronic
1019198825 6:170297311-170297333 AAAGGGAGGCGGGGGCGGCGGGG - Intronic
1019294151 7:265109-265131 AGGGGTAGGAGGGGCAGGAGGGG + Intergenic
1019323317 7:425288-425310 TGGGGAGGGCAGGGCCGGAGCGG + Intergenic
1019463949 7:1176179-1176201 AAGGGGAGCCGGGGCAGCAGGGG + Intergenic
1019525326 7:1478076-1478098 GAGTGCAGCCGGGGCCGGAGAGG + Intronic
1019536650 7:1532929-1532951 CAGGGAGGGTGGGGACGGAGCGG - Intronic
1019536981 7:1534335-1534357 AAGGGTAGGTGGGGCCGCTGTGG - Intronic
1019577483 7:1744500-1744522 GAGGGATGGAGGGGCGGGAGGGG - Exonic
1019735209 7:2647042-2647064 GACGGAGGGCGGGGCCAGAGGGG + Intronic
1019830300 7:3321743-3321765 AAGGGAGGGAGGGGAAGGAGGGG - Intronic
1019932078 7:4230386-4230408 AAGGGAAGGGAGGGCAGGGGAGG + Intronic
1020073065 7:5240215-5240237 AAGGCAGGGCGGGGGCGGGGAGG - Intergenic
1020175958 7:5882288-5882310 GAGGGAAGACTGGGGCGGAGGGG + Intronic
1020201246 7:6081602-6081624 CTGGGCAGGCGGGGCAGGAGGGG + Intergenic
1020796754 7:12686638-12686660 GAGGGAAGGCGGTGCCGGGCGGG + Intergenic
1021452938 7:20798511-20798533 AGGGGCAGGCCGGGCGGGAGGGG + Intergenic
1021801978 7:24316516-24316538 AGGGCAGGGCGGGGTCGGAGTGG - Intergenic
1022459976 7:30595398-30595420 AAGGGAGAACGGAGCCGGAGAGG - Intronic
1023609459 7:41958562-41958584 AAGGGAAGGGAGGGTGGGAGAGG - Intergenic
1024323109 7:48089075-48089097 CGGGGGAGGCGGGGCCAGAGGGG + Intronic
1026245008 7:68612166-68612188 AAGGGAAGGGAGGGCAGGGGAGG - Intergenic
1026743730 7:72995344-72995366 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
1026786083 7:73302386-73302408 AAGGAAAGGCTGGGCTGCAGAGG - Intergenic
1026803646 7:73416015-73416037 AAGGGAAGGGAGGGGAGGAGAGG + Intergenic
1026841843 7:73673701-73673723 ATGGGAAGCCAGGGCAGGAGGGG - Intergenic
1027100005 7:75369733-75369755 AAGGGAAGGGAGGGGAGGAGAGG - Intergenic
1027195505 7:76027297-76027319 AAGGGAAGAGGGGACAGGAGGGG + Intronic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027367828 7:77476922-77476944 AAGGGTAGGGGGGGCCACAGAGG - Intergenic
1027988286 7:85323342-85323364 AAGGGAAAGTGGGCCCGGCGCGG - Intergenic
1029082870 7:97988731-97988753 GAGGGAAGACCGGGGCGGAGGGG - Intronic
1029087020 7:98019769-98019791 AAGGGAAGGAAGGGAGGGAGCGG - Intergenic
1029123029 7:98281294-98281316 GGGGGAGGGCGGGGCCTGAGAGG - Intronic
1029443273 7:100599969-100599991 AAGGGACGGGGGGGCTGGGGTGG - Intronic
1029470906 7:100753415-100753437 GAGGGATGGCAGGGCTGGAGTGG + Intronic
1030121350 7:106113014-106113036 AAGGAAAGGCGTGGCCGGACAGG + Intergenic
1031329818 7:120450850-120450872 AAGGGAAGGCTGAGTAGGAGAGG - Intronic
1032074585 7:128830389-128830411 AAGGGCGGGCTGGGCCGGGGCGG - Exonic
1032089518 7:128904244-128904266 AAGGGATGGCGGGGCAGGGCAGG + Intronic
1032845354 7:135747555-135747577 GAAGGAAGGAGTGGCCGGAGTGG - Intronic
1033654241 7:143362461-143362483 AGGGCAAGGCGGGTGCGGAGCGG + Intronic
1034264050 7:149772921-149772943 AAGGGAGGGCAAGGCCGGCGCGG - Intronic
1034355548 7:150448357-150448379 AAGGGAAGGCCGCGCGGGAAAGG - Intergenic
1035049623 7:155991005-155991027 AAGGGAAGGAAGGCCAGGAGCGG - Intergenic
1035289699 7:157830045-157830067 GAGGGAGGGTGGGGCAGGAGGGG - Intronic
1035321478 7:158032341-158032363 CGGGGAAGGAGGGGCAGGAGAGG - Intronic
1037764914 8:21766722-21766744 CAGGGAGGGAGGGGCCAGAGCGG - Intronic
1037788915 8:21919731-21919753 GGGGGGAGGGGGGGCCGGAGAGG + Exonic
1038933671 8:32223783-32223805 AAGGGAAGGGAGGCCCGTAGCGG + Intronic
1039964083 8:42271406-42271428 CGGGGAAGGCGGGGCTGGGGCGG - Exonic
1040027215 8:42792814-42792836 AAGGGAAGGTGGGCCAGGCGCGG + Intronic
1042564785 8:70100775-70100797 TAGTGAAGGTGGGGCAGGAGGGG - Intergenic
1043003343 8:74786669-74786691 ATGGGAAGGGGGTGCAGGAGGGG - Intronic
1043431699 8:80201506-80201528 AAGTGGAGGCGGGGGCGGGGAGG - Intronic
1043684025 8:83065894-83065916 AAGGGGAAGCAGGGCTGGAGGGG - Intergenic
1043908432 8:85833321-85833343 AAGGGAAGGGGGGGGAGGGGAGG - Intergenic
1044705348 8:95003194-95003216 AAAGGAAGGAGGGGCCGTGGAGG + Intronic
1045447590 8:102283332-102283354 AGGGGAAGGCGGGGGGGGGGGGG + Intronic
1045483809 8:102614374-102614396 GAGGGAAGGAGGGGAAGGAGAGG - Intergenic
1047292189 8:123540798-123540820 AGGGGCAGGCAGGGCTGGAGCGG - Intronic
1048261180 8:132946587-132946609 AAGGAAAGGAGGGGAAGGAGGGG - Intronic
1048990835 8:139759254-139759276 AAGGGAAGGCAAAGCCGGAAGGG + Intronic
1049406691 8:142454762-142454784 GAGGGAGGGTGGGGCAGGAGTGG - Intronic
1049574708 8:143384759-143384781 AAGGCAGGGCTGGGCAGGAGGGG + Intergenic
1049646179 8:143736794-143736816 CAGTGAAGGCGGGGCTGGGGTGG - Intergenic
1049803802 8:144530023-144530045 AAGGGAAGGAGAGACCGGGGCGG + Exonic
1049843382 8:144788075-144788097 GCGGGGAGGCGGGGCTGGAGTGG + Intergenic
1049901893 9:176968-176990 AAGGGAAGGGGGGAATGGAGGGG + Intronic
1050143246 9:2538614-2538636 AAGGGAAGGTGGAGGCGGAAGGG - Intergenic
1050264591 9:3876683-3876705 AAGGGAGGGAGGGGAGGGAGGGG + Intronic
1051193022 9:14534518-14534540 AAGGGAAGCAGGGGAAGGAGCGG + Intergenic
1051851667 9:21516468-21516490 AAGGGAAGGTGGGGGATGAGGGG + Intergenic
1053157470 9:35791331-35791353 AATGGAAGGAGGGGCGGCAGGGG + Intergenic
1053293342 9:36896572-36896594 CAGGGAAGGGAGGGCTGGAGAGG - Intronic
1053744927 9:41187255-41187277 AAGGGAAGGGGGGAATGGAGGGG + Intronic
1054454061 9:65420501-65420523 AAGGGAGGGAAGGGACGGAGGGG + Intergenic
1054482344 9:65677958-65677980 AAGGGAAGGGGGGAATGGAGGGG - Intronic
1054683421 9:68244013-68244035 AAGGGAAGGGGGGAATGGAGGGG - Intronic
1055316542 9:75039813-75039835 AAGGGAAGGGAGGGAAGGAGAGG - Intergenic
1055640481 9:78315548-78315570 AAGGGAAGGCAGGGAGGAAGAGG - Intronic
1056333241 9:85539374-85539396 AAGGGAACTGGGGGTCGGAGAGG - Intergenic
1056523931 9:87425283-87425305 AAAGGAAGGAGGGGAGGGAGAGG + Intergenic
1056962505 9:91138635-91138657 AAAGGAAGGGGAGGCAGGAGGGG - Intergenic
1057164361 9:92914394-92914416 AAGGGGAGGCTGGGTGGGAGGGG + Intergenic
1057490067 9:95513708-95513730 CAGGGAAGTCGGGGACGGGGTGG + Intronic
1057814948 9:98287347-98287369 AAGGGGAGTTGGGGCTGGAGAGG + Intergenic
1058957009 9:109958680-109958702 AAGGGAAGGAGAGGAAGGAGAGG + Intronic
1059063719 9:111060388-111060410 AAGGGAAGAAAGGGCGGGAGAGG + Intergenic
1059191793 9:112333715-112333737 GAGGGAGGGCGGGGACGGTGAGG - Intergenic
1059391854 9:114004314-114004336 CAGGAAAGGCGGGGCTGGAGGGG - Intronic
1059989558 9:119852550-119852572 AAGGGAAGGAGGGGAGAGAGAGG - Intergenic
1060171078 9:121461565-121461587 AAGGGAAAAGGGGGCTGGAGTGG + Intergenic
1060215510 9:121736318-121736340 AGGGGCTGGCGGGGCCGGTGGGG + Intronic
1060679371 9:125547608-125547630 AGGGGAAGGAGGGGCTGAAGTGG - Intronic
1060734196 9:126055877-126055899 AAGGAAAGGCTGGCCTGGAGGGG + Intergenic
1060779606 9:126401752-126401774 GAGGGAAGGCGGGGTTGGAGAGG - Intronic
1060858237 9:126933114-126933136 AAAGGAAGGCGGCGCTGGTGTGG + Intronic
1061168932 9:128940834-128940856 AAGAGAAGGAGGGGCTGGATGGG + Intronic
1061237428 9:129351149-129351171 CGGGGAAGGCGGGGCTGAAGAGG - Intergenic
1061249166 9:129416489-129416511 GCGGGAGGGCGGGGCTGGAGGGG - Intergenic
1061276183 9:129570392-129570414 AAGGGCAAGAGGGGCCAGAGAGG + Intergenic
1061369715 9:130191516-130191538 AAGGGAAGTGGGGGCCGGTAGGG + Intronic
1061464469 9:130766756-130766778 AAGGCAGGGTGGGGCCGGGGTGG - Intronic
1061821318 9:133228468-133228490 ATGGGAAGGCTGGGCTGGAGGGG - Intergenic
1061834129 9:133317895-133317917 ATGGGAAGGGTGGGCTGGAGGGG + Intergenic
1062014195 9:134283080-134283102 AGGGCAAGGCGGGGGGGGAGGGG - Intergenic
1062060428 9:134492580-134492602 CAGGGAACGCGGGGCCAGTGAGG + Intergenic
1062237928 9:135521599-135521621 ATGGGAAGGCTGGGCTGGAGGGG + Intronic
1062324949 9:136008324-136008346 AGAGGAAGGCAGGGCAGGAGAGG + Exonic
1062393238 9:136342374-136342396 AAGGAAAAGGGGGGCCGGAGTGG + Intronic
1062620402 9:137417898-137417920 AGGGGCTGGCGGGGCCGGAGGGG + Intronic
1062696238 9:137877698-137877720 CAGGGTGGGCGGGGCCGGCGCGG + Intergenic
1203780007 EBV:96000-96022 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780011 EBV:96009-96031 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780031 EBV:96063-96085 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780061 EBV:96144-96166 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780091 EBV:96225-96247 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780110 EBV:96276-96298 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780129 EBV:96327-96349 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203746945 Un_GL000218v1:45178-45200 CAGGGAAGAGGAGGCCGGAGGGG - Intergenic
1203563162 Un_KI270744v1:74302-74324 CAGGGAAGAGGAGGCCGGAGGGG + Intergenic
1185512741 X:675698-675720 AGGGGAAGGCAGGGACGCAGGGG - Intergenic
1185581345 X:1213195-1213217 AAGGGAAGGGGGAGGGGGAGGGG - Intergenic
1185640473 X:1587767-1587789 AAGGGAAGGGAGGGGAGGAGAGG - Intergenic
1185869220 X:3649783-3649805 AAGGGAGGGAGGGGAGGGAGAGG + Intronic
1186064109 X:5742966-5742988 AGGGGAAGGAGGGGAAGGAGAGG + Intergenic
1186072107 X:5833231-5833253 AAGGGAAGAGGGGGACGAAGAGG - Intergenic
1189319621 X:40079858-40079880 AAGGGCAGCAGGGGCCGGAGAGG - Intronic
1189325041 X:40106761-40106783 AACGGAAGGCGGTGCAGGCGGGG + Intronic
1189733372 X:44045224-44045246 AAGGGAAAGAGGGGTGGGAGTGG - Intergenic
1190259840 X:48790906-48790928 AAGAGAAGGAGGGGAAGGAGAGG + Intronic
1190264971 X:48822826-48822848 CAGGGAAGGAGGGGGCTGAGGGG + Intronic
1190385516 X:49879574-49879596 AGGGGAAGGCGGAGGCGGCGGGG + Intergenic
1190732990 X:53236720-53236742 AAGGGAAGGCTGAGCAGGAAGGG - Intronic
1191904861 X:66077147-66077169 AAGGGAAGGAGGGGAGGGAAGGG - Intergenic
1192177478 X:68895012-68895034 AAGGGAGGGCAGGGGCGGAGAGG - Intergenic
1192453000 X:71254785-71254807 AAGGGAAGGAGGGGCACGTGAGG - Intronic
1194627560 X:96243322-96243344 AAGGAAAGGCTGGGCCAAAGTGG + Intergenic
1194845956 X:98809408-98809430 AAGGAAAGGAAGGGACGGAGAGG - Intergenic
1198254844 X:134915463-134915485 AAGGGGAGGCGGGAGGGGAGGGG - Intergenic
1200061194 X:153484558-153484580 AAGGCAGGGTGGGGCCGCAGTGG + Intronic
1200066421 X:153506247-153506269 AAGAGAAGACTGGGCCAGAGGGG + Intronic
1200696737 Y:6367579-6367601 AAGGGAATGTGGGGATGGAGTGG + Intergenic
1201037376 Y:9797120-9797142 AAGGGAATGTGGGGATGGAGTGG - Intergenic