ID: 978503632

View in Genome Browser
Species Human (GRCh38)
Location 4:109434087-109434109
Sequence CTGGCCCCGAACGCCCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978503632_978503648 15 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503648 4:109434125-109434147 CGGGAGCGGGCGCGGTGCGGAGG 0: 1
1: 0
2: 4
3: 75
4: 596
978503632_978503647 12 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503647 4:109434122-109434144 GGACGGGAGCGGGCGCGGTGCGG 0: 1
1: 0
2: 1
3: 59
4: 471
978503632_978503653 29 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503653 4:109434139-109434161 GTGCGGAGGCCGCGGGGTCCGGG 0: 1
1: 0
2: 1
3: 32
4: 321
978503632_978503643 2 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503643 4:109434112-109434134 CCGGCCCGAGGGACGGGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 235
978503632_978503651 23 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503651 4:109434133-109434155 GGCGCGGTGCGGAGGCCGCGGGG 0: 1
1: 0
2: 8
3: 44
4: 398
978503632_978503637 -5 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503637 4:109434105-109434127 GCCAGGCCCGGCCCGAGGGACGG 0: 1
1: 0
2: 1
3: 32
4: 337
978503632_978503650 22 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG 0: 1
1: 0
2: 8
3: 58
4: 484
978503632_978503646 7 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503646 4:109434117-109434139 CCGAGGGACGGGAGCGGGCGCGG 0: 1
1: 0
2: 4
3: 30
4: 321
978503632_978503639 -4 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503639 4:109434106-109434128 CCAGGCCCGGCCCGAGGGACGGG 0: 1
1: 0
2: 4
3: 24
4: 306
978503632_978503635 -10 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503635 4:109434100-109434122 TCGGGGCCAGGCCCGGCCCGAGG 0: 1
1: 0
2: 4
3: 30
4: 350
978503632_978503649 21 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503649 4:109434131-109434153 CGGGCGCGGTGCGGAGGCCGCGG 0: 1
1: 0
2: 6
3: 69
4: 471
978503632_978503641 1 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503641 4:109434111-109434133 CCCGGCCCGAGGGACGGGAGCGG 0: 1
1: 0
2: 0
3: 18
4: 202
978503632_978503636 -9 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503636 4:109434101-109434123 CGGGGCCAGGCCCGGCCCGAGGG 0: 1
1: 0
2: 0
3: 30
4: 308
978503632_978503652 28 Left 978503632 4:109434087-109434109 CCGGGAAGGGCGTTCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 978503652 4:109434138-109434160 GGTGCGGAGGCCGCGGGGTCCGG 0: 1
1: 0
2: 2
3: 40
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978503632 Original CRISPR CTGGCCCCGAACGCCCTTCC CGG (reversed) Intronic
900610555 1:3542862-3542884 CTGGCCCCGAGCTCACCTCCAGG - Intronic
900883718 1:5401074-5401096 TTGACCCCAAAGGCCCTTCCTGG + Intergenic
901316697 1:8314772-8314794 CTGGCCCCGTAGACCCCTCCAGG + Intergenic
901637198 1:10675895-10675917 CTGGCCCGGACCGGCCTGCCAGG - Intronic
906209013 1:44002029-44002051 CTGGCCCCCAACTCCTTTTCTGG + Intronic
907972179 1:59393845-59393867 TTGGCCCCCAACCCCCTCCCAGG + Intronic
909133783 1:71771291-71771313 CTAGCCCCGAACCCCCTGACAGG - Intronic
910476214 1:87610268-87610290 CTGACCCCGAAGGCAATTCCAGG + Intergenic
915126725 1:153670715-153670737 CTGGGCCCGAACCCCATCCCGGG + Intronic
920253809 1:204640487-204640509 CAGCCCCTGAACGCCCTTCCAGG - Intronic
1062874482 10:932597-932619 CCTGCCCCGAACGCCCCACCCGG + Intergenic
1064250899 10:13705725-13705747 CTGGCCGCGAAACCCCTTGCAGG + Intronic
1073544859 10:104339120-104339142 CTGGTCTCGAACTCCCTTCTCGG + Intergenic
1076192351 10:128491656-128491678 CTGGCCTTGCACACCCTTCCTGG - Intergenic
1077590335 11:3486026-3486048 CTGGCCCAGGAGGTCCTTCCGGG - Intergenic
1078022073 11:7664669-7664691 CTGGCTCCCAAGGCCCTTCTTGG - Intergenic
1080742925 11:35082524-35082546 GTGGCCTCGCACGCCTTTCCTGG - Intergenic
1083841138 11:65304947-65304969 CTGGCCCCCAAAACCCTTGCGGG + Intronic
1084246053 11:67857807-67857829 CTGGCCCAGGAGGTCCTTCCGGG - Intergenic
1084826620 11:71736693-71736715 CTGGCCCAGGAGGTCCTTCCGGG + Intergenic
1084890552 11:72234692-72234714 CTGGCCCCACACTCCCTCCCAGG - Intronic
1089293157 11:117450529-117450551 CTGGCCCTGAACTCACTTACCGG + Exonic
1091771680 12:3156239-3156261 CTGGCCCTGCACAACCTTCCGGG - Intronic
1092416633 12:8294932-8294954 CTGGCCCAGGAGGTCCTTCCGGG - Intergenic
1095349369 12:41189905-41189927 CTGGCCCCGAACTGCGCTCCTGG + Intronic
1096779066 12:53981897-53981919 CTGGCCCCTTTCTCCCTTCCCGG - Intergenic
1100559967 12:95738413-95738435 CTCGCCCAGAATGCTCTTCCTGG - Intronic
1103595537 12:122022495-122022517 CCGGCCCCGAGCCCCCCTCCCGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113710987 13:112465412-112465434 GTGGCTCCAAACGCCTTTCCTGG - Intergenic
1113791963 13:113033709-113033731 CTGGCCCCGGTCGCCCTCCATGG + Intronic
1113859458 13:113471815-113471837 CTGTCCCCAAAAGCACTTCCTGG + Intronic
1113909275 13:113834517-113834539 CTGGCCCCGCGGGCCCTTCACGG - Intronic
1114640559 14:24216947-24216969 CTGGCCCAGAGGGCCCTTGCTGG - Exonic
1114674513 14:24431401-24431423 CTGGCCCAGATCACCCCTCCTGG - Intronic
1116504811 14:45665256-45665278 CTGGCCCAGGACTCCCTTCAGGG + Intergenic
1121994668 14:98592998-98593020 CTGGCCTCCCACGCCCATCCCGG + Intergenic
1122883238 14:104699437-104699459 CAGGTCCCCAACGCCCCTCCTGG - Intronic
1123401092 15:19987592-19987614 GTGGCCCCGCACGCCCCTGCAGG + Intergenic
1127369877 15:58329906-58329928 CTGGCCCTGAATGCCCATCCTGG + Intronic
1129600472 15:76995456-76995478 CTGGCCCAGGCCCCCCTTCCCGG - Exonic
1129687995 15:77697188-77697210 CTGACCCCGAAGACCTTTCCTGG - Intronic
1130154201 15:81335673-81335695 CTAGCCCCTAAAGCCCTTCTGGG + Intronic
1132602767 16:781379-781401 CTGCACCCAAACCCCCTTCCTGG - Intronic
1133784673 16:8964338-8964360 CTGACCCCAAGCTCCCTTCCGGG - Intronic
1139491443 16:67288226-67288248 GGGGCCTCGAACTCCCTTCCTGG + Exonic
1139780753 16:69349550-69349572 CTGGCCCCGAACACCCTGGGAGG + Exonic
1141996775 16:87641000-87641022 CCACACCCGAACGCCCTTCCAGG - Intronic
1142688563 17:1591588-1591610 CTGGCCCCTTGAGCCCTTCCCGG - Exonic
1143362971 17:6386651-6386673 ATGCCCCAGAACGCCCGTCCTGG + Intergenic
1145941161 17:28744077-28744099 CTGGCCCCGCTCGCCCGTGCCGG + Exonic
1146057483 17:29588723-29588745 CTGGCCCTGAACGCCAGGCCCGG + Intronic
1147120050 17:38330523-38330545 CTGGCCCTGAGGGGCCTTCCTGG + Exonic
1147765569 17:42833515-42833537 CGGGACCCGACCGCCCTTGCTGG - Exonic
1147875362 17:43617067-43617089 ATGGCCCTGAACCCACTTCCAGG + Intergenic
1147986832 17:44311834-44311856 CAGGCCCCCAAGCCCCTTCCAGG + Intronic
1151625004 17:75271045-75271067 CGCGCCCGGAACGCCCCTCCCGG + Exonic
1152938263 17:83152926-83152948 CTGACCCCGAATGCCCTGCTGGG - Intergenic
1154158212 18:11959983-11960005 CTGACCCCGACCTCCCTCCCGGG - Intergenic
1157560098 18:48639711-48639733 CCAGCCCCAAACGCCCATCCAGG - Intronic
1160009012 18:75089705-75089727 GTGGCCCCGAAAGACTTTCCTGG - Intergenic
1163823195 19:19508047-19508069 CTGGTCCCGAGAGCCCTACCAGG + Exonic
1165996665 19:39848619-39848641 CTGGCCCTGAGCCCCCTGCCTGG - Intergenic
1166520223 19:43475188-43475210 CCGGCCCCTAAGGCCCTGCCCGG - Exonic
1166542252 19:43613074-43613096 CTGGCTCAGAATTCCCTTCCGGG - Exonic
1167490771 19:49791832-49791854 CTGGCCTCGCACACCCTTCCTGG + Intronic
929614184 2:43295343-43295365 CTTGCCTCAAACGCTCTTCCAGG + Intronic
935083767 2:99824848-99824870 TTGGCCCAGAACTCCATTCCTGG - Intronic
937828362 2:126392475-126392497 CTAGCCCCTAAGGCCCTTTCAGG + Intergenic
938091933 2:128440089-128440111 GTGGCCCCAAACCACCTTCCTGG - Intergenic
944057136 2:195534449-195534471 CTGGCCTCCAAGGCCCTTTCTGG - Intergenic
947739291 2:232477777-232477799 CTGGCTGTGAAGGCCCTTCCTGG - Intergenic
948864057 2:240766538-240766560 CTGGGCCCCAACACGCTTCCCGG + Intronic
948883985 2:240874007-240874029 AAGGCCCTGAACGCCCCTCCAGG + Exonic
1172547363 20:35772214-35772236 CTGGCCCCGCTCGCCCAGCCTGG + Intronic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1173672128 20:44806041-44806063 CTGGGCTGGAAAGCCCTTCCTGG - Intronic
1176126633 20:63478467-63478489 CTGCCCCCGTCCTCCCTTCCTGG + Intergenic
1176206184 20:63889482-63889504 CTGGTCCCCACTGCCCTTCCTGG + Intronic
1176206191 20:63889501-63889523 CTGGTCCCCACTGCCCTTCCTGG + Intronic
1178725892 21:35051442-35051464 CTGGCCCTGCACGGCCTTCCTGG + Intronic
1182338436 22:29600970-29600992 CTGGCCCTGACCTCCCTTCTGGG + Intergenic
1183508202 22:38220844-38220866 GGGGCCCTGAATGCCCTTCCTGG + Exonic
1185094450 22:48798692-48798714 CTGGCCCCGAAGCTCCTTCAGGG - Intronic
1185270978 22:49929268-49929290 CTGGCCCCGACCCCCCTCCGAGG - Intergenic
1185310179 22:50150009-50150031 CTGGCCCTGTCCGCCCCTCCAGG - Intronic
1185314537 22:50173370-50173392 CTGCCCCCGAGCACCCTCCCAGG + Intronic
951031064 3:17882161-17882183 ATGGCCCAGAAAGCCCTTCATGG - Intronic
954360586 3:50120692-50120714 CCGGCCCGGAAAGCTCTTCCAGG + Intergenic
960066890 3:113383898-113383920 CTAGCCCCCAACCCCCTGCCAGG + Intronic
961081792 3:124033819-124033841 CTGGCCCCCCGCGCCCTGCCCGG - Intergenic
961508961 3:127389752-127389774 CTGGCTCAGGAAGCCCTTCCTGG - Intergenic
964809834 3:160651743-160651765 CTGACCCCCAATGCCCCTCCAGG + Intergenic
968196650 3:196712491-196712513 CTGGCCCCGCGCGCCCCTCTCGG + Exonic
968555271 4:1243687-1243709 CTGGCCTCCTACGGCCTTCCTGG + Intronic
969004273 4:4006608-4006630 CTGGCCCAGCACGTCCTCCCGGG - Intergenic
969432391 4:7163011-7163033 CTGGCGCTGAAAGCTCTTCCCGG + Intergenic
978503632 4:109434087-109434109 CTGGCCCCGAACGCCCTTCCCGG - Intronic
982762200 4:159298721-159298743 TTGGCCACGAAAGCCCTTTCTGG + Intronic
985757026 5:1725285-1725307 CTGGTCCTCAACGCCGTTCCGGG + Intergenic
986858770 5:11903607-11903629 CTAACCCCGGACCCCCTTCCAGG + Intronic
988377467 5:30455780-30455802 CTTGCCCCCAACGCCCTGACAGG + Intergenic
997585440 5:135040507-135040529 GTGGCCCCGCAGGCCGTTCCTGG + Intronic
998018822 5:138753339-138753361 CCGGCCCCGCCCGCCCTTCCTGG - Intronic
1002093564 5:176818107-176818129 CTGCCCCTGCCCGCCCTTCCCGG + Intronic
1002494064 5:179599826-179599848 CTGGCCCTGAAGGCCCCTCCGGG - Intronic
1004044185 6:12010941-12010963 CTGTCCCCGAAGTCCCCTCCCGG + Intronic
1006097620 6:31665842-31665864 CGGGCCCCGAACGCCATACCTGG + Exonic
1006239418 6:32664717-32664739 CTCGCCCCCATCGCCCCTCCCGG + Intronic
1006375162 6:33667965-33667987 GTGGGCCCGAACCCCCTCCCCGG + Intronic
1011408410 6:87040167-87040189 CTGGCTCCTAAAGCCATTCCAGG - Intergenic
1018458273 6:163972121-163972143 CTGGCCCAGCGCCCCCTTCCAGG - Intergenic
1018681594 6:166270108-166270130 CTGCCCTCGAGGGCCCTTCCTGG - Intergenic
1020324407 7:6963109-6963131 CTGGCCCAGCAGGTCCTTCCGGG - Intergenic
1029125726 7:98293992-98294014 TGGGCACCGAAGGCCCTTCCGGG + Intronic
1034188874 7:149198530-149198552 CTGTCCCCGTGCGCCCCTCCAGG - Exonic
1034196235 7:149250326-149250348 CTGTCCCCGTGCGCCCCTCCAGG - Exonic
1034527642 7:151675753-151675775 CTGCCCCCGACGTCCCTTCCTGG - Intronic
1035623399 8:1052163-1052185 CTGGGCCCGGCCGCCCTTCCTGG + Intergenic
1036371660 8:8167843-8167865 CTGGCCCAGCAGGTCCTTCCGGG + Intergenic
1036879243 8:12497801-12497823 CTGGCCCAGCAGGTCCTTCCGGG - Intergenic
1037956963 8:23067919-23067941 CTGGCCCCAAGCGCAGTTCCAGG + Intronic
1038480296 8:27897155-27897177 CTGGCCCCAAACACCCTCCAAGG + Intronic
1039214643 8:35256465-35256487 ATAGCCCCGAACGCCCTGACGGG + Intronic
1040469933 8:47728655-47728677 CAGGCCCTGACCTCCCTTCCTGG + Intronic
1044854670 8:96462931-96462953 CTTGCCCTGAAAGCCCTGCCAGG + Intergenic
1047925477 8:129678773-129678795 CTGGCCCAGGACACCCTGCCAGG - Intergenic
1050637388 9:7626667-7626689 CTGGCTCAGCACCCCCTTCCAGG - Intergenic
1052130198 9:24835373-24835395 GTGGCCCAGAATACCCTTCCAGG - Intergenic
1052301276 9:26955502-26955524 CTGCCCCCCAACACCCTTACAGG - Intronic
1057777840 9:98025350-98025372 CTGGCCCCGAGAGCTCTTTCTGG - Intergenic
1058980190 9:110161752-110161774 ATGGCCCCCAACGACCTTGCTGG + Intronic
1060123943 9:121023991-121024013 CTGGTCTCGAACTCCCTTTCAGG - Intronic
1060584470 9:124777434-124777456 CTGGCCCCGGGCTCCCTCCCGGG - Intronic
1061873206 9:133531534-133531556 CTGTCCCCGAGCTTCCTTCCTGG - Intergenic
1062061326 9:134496872-134496894 CAGGCCCCGACCATCCTTCCAGG + Intergenic
1062342637 9:136100564-136100586 CTGGCCCCTCACTCTCTTCCAGG - Intergenic
1062560251 9:137138478-137138500 CTGGCCCCGAACACACCTCGCGG + Intronic
1187710221 X:22045804-22045826 ATGGCCCCAAGCTCCCTTCCAGG + Intronic
1194521684 X:94926674-94926696 CAGCCCCCGACTGCCCTTCCCGG - Intergenic