ID: 978508810

View in Genome Browser
Species Human (GRCh38)
Location 4:109492961-109492983
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978508810_978508816 -8 Left 978508810 4:109492961-109492983 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 978508816 4:109492976-109492998 TTCCAAAGTGTTGGGATAATAGG 0: 3
1: 179
2: 5277
3: 68511
4: 360066

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978508810 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr