ID: 978516721

View in Genome Browser
Species Human (GRCh38)
Location 4:109576740-109576762
Sequence GGTTAGTACACCATCCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978516721_978516729 15 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516729 4:109576778-109576800 TGGGCAAGATGAAGGGGTTGTGG 0: 1
1: 1
2: 2
3: 41
4: 440
978516721_978516724 -4 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 101
978516721_978516726 7 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516726 4:109576770-109576792 ACTATTGATGGGCAAGATGAAGG 0: 1
1: 0
2: 0
3: 8
4: 145
978516721_978516727 8 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516727 4:109576771-109576793 CTATTGATGGGCAAGATGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 111
978516721_978516723 -5 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516723 4:109576758-109576780 TAACCTTGGACTACTATTGATGG 0: 1
1: 0
2: 0
3: 6
4: 80
978516721_978516728 9 Left 978516721 4:109576740-109576762 CCACTAGGGATGGTGTACTAACC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 978516728 4:109576772-109576794 TATTGATGGGCAAGATGAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978516721 Original CRISPR GGTTAGTACACCATCCCTAG TGG (reversed) Intronic